Monday
December 22, 2014

Homework Help: Science: Biology

Recent Homework Questions About Biology

Post a New Question | Current Questions

biology
difference between gaseous exchange, respiration and breathing
Friday, June 10, 2011 at 10:55am

biology
I did a lab with catalase breaking down hydrogen peroxide. A question asks, what gas is being formed (oxygen), suggest a method I could use to determine this. I don't know any method?
Thursday, June 9, 2011 at 9:54pm

BIOLOGY
WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA
Tuesday, June 7, 2011 at 2:30pm

Biology
a cell is placed in distilled water and then transferred to a 5% salt solution. aw a result of this procedure, the cell would be likely yo?
Thursday, June 2, 2011 at 7:42pm

Biology
Wha advantage could the following traits be to the organism ? a) Larger leaves b)Green Leaves c) More seeds d) Brightly coloured flowers
Wednesday, June 1, 2011 at 6:56pm

biology
1. Record your observations of the roots of the bean and radish plants in the appropriate data chart. Be sure to include a sketch of each plant’s roots. Answer: Data Chart: Bean Plant Nodules present? Number of nodules Number of pink nodules Number of green nodules Sketch...
Wednesday, June 1, 2011 at 3:38pm

English
Could you please check these adjectives referring to personality? Thank you very much. 1) I'm outgoing, sensible, sincere, touchy and hard-working. 2) I'm quite confident about myself. I'm anxious about next week's biology test. 3) If I were you, I'd study ...
Wednesday, June 1, 2011 at 10:16am

Biology
What kind of animals have eggs that contain yolk? Do all eggs have yolk?
Sunday, May 29, 2011 at 9:13pm

Biology
What are the advantages of a Co-repressor?
Sunday, May 29, 2011 at 1:42pm

biology
What are different ways antibodies can react with antigens, that aids in preventing a host from being infected.
Wednesday, May 25, 2011 at 10:17pm

Biology
What is in urine after in has been filtered thrigh the kidneys?
Wednesday, May 25, 2011 at 12:23pm

Biology(HELP ME!!!)
An average person blinks their eyes about 20 times per minute. Estimate the number of times a person will blink in 1 year.
Monday, May 23, 2011 at 7:55pm

SCIENCE(biology)
define sustainable agriculture
Sunday, May 22, 2011 at 6:37am

I really need help with biology!!
I need help understanding my bio assignment. Can you tell me weather or not I got them right and if I didnt get them right can you correct them and tell me the right answer to give me a better understanding? I put a star (*) next to my answer. 1. Which type of muscle makes up ...
Friday, May 20, 2011 at 11:14pm

biology
true or false? a mammal that can learn to find its way through a maze more quickly than another mammal probably has a better developed cerebellum
Friday, May 20, 2011 at 5:03pm

Biology
true or false Ciliates use flagella for feeding and movement?
Friday, May 20, 2011 at 4:44pm

biology/honors
Charle Darwin made theory of natural selection but couldnt explain why there is variation within populations. Explain two reasons why there is variation within population ? PLEASE help me answer this question is for my test
Friday, May 20, 2011 at 2:39pm

biology
why is the cell membrane important to people?
Thursday, May 19, 2011 at 8:39pm

biology/honors
How does genetic variation lead to speciation ? Can you help me answer this question please for the review test ? thank you .
Thursday, May 19, 2011 at 7:36pm

biology/honors
Can someone help answer this question please is one of my study guide for the test? What are some adaptation that hominid populations developed as opposed to primates ? thank you
Thursday, May 19, 2011 at 6:29pm

biology
compare the size of a guard cell to the size of a chloroplast. does the guard cell have room for more chloroplast
Wednesday, May 18, 2011 at 9:50pm

Biology
Among protostomes, which morphological trait has shown the most variation? A. Type of symmetry (bilateral vs. radial vs. none) B. Type of body cavity (coelom vs. Pseudocoelom vs. acoelom) C. Number of embryonic tissue types (diploblastic vs. triploblastic) D. Cephalization (...
Wednesday, May 18, 2011 at 5:25pm

biology
do mutations form new or old genes????
Wednesday, May 18, 2011 at 1:34am

biology
i need a short story about a ecosystem that is disturbed and undergoes succession
Tuesday, May 17, 2011 at 7:10pm

Biology Help!
what r Unstable elements that give off radiation what r Tiny vesicles that form when short chauns of amino acids gather together
Tuesday, May 17, 2011 at 5:49pm

Biology
The half life of carbon 14 is 5700 years. If the carbon 14 level measured in a fossilized bone has only 1/4 of the original amount, how old in the bone?
Monday, May 16, 2011 at 8:07pm

Biology
Does the circulatory system transport red and white blood cells? If so, how?
Sunday, May 15, 2011 at 9:13am

Biology
Name two ways in which antibodies in the blood will prevent a pathogen from making you sick. This is all I can think of: 1. An antigen in the body will bind to an antibody that was made by...
Friday, May 13, 2011 at 1:42pm

biology pleaseehelp!
In order to produce many copies of a protein fast, the cell uses A. DNA replication. B. intron self-splicing. C. single-unit ribosomes for high speed translation. D. codon-anticodon reciprocal duplication. E. many RNA polymerase molecules to produce mRNA transcripts at the ...
Friday, May 13, 2011 at 1:49am

biology
can alcohol go through a visking tubing?
Thursday, May 12, 2011 at 9:23am

biology
Discuss possible benefits and drawbacks of a transgenic organism such as Bt corn?
Wednesday, May 11, 2011 at 2:23pm

biology
Are different species always fery different?
Tuesday, May 10, 2011 at 12:45am

Biology
The number of oyster beds in Chesapeake Bay,which is an arm of the Atlantic Ocean,is dwindling rapidly.what effect would this have on the surrounding area?On the human community?
Tuesday, May 10, 2011 at 12:27am

Biology 1
What is a Biochemical cycle and why is it important? Give at least one example.
Monday, May 9, 2011 at 8:56pm

Grade 12 Biology
If a life-form has six different bases-ABCDEFG. the percentage composition of A,B and C is same as EFG. Hypothesis the structure of the nucleic acid. I TRIED the search engine but didnt help, please help!
Monday, May 9, 2011 at 3:43pm

biology
Would you like to help me answers some of my questions in Biology? 1/ Darwin concluded that the most well adapted individuals in a population will leave the most offspring for future generations. This can be considered a measure of an individual's.. a/ phylogeny b/ family ...
Sunday, May 8, 2011 at 11:03pm

Biology
How would you perform a 5 x 10^-3 dilution of any culture or chemical reagent?
Sunday, May 8, 2011 at 8:25pm

Anthropology
How does the identification of cultural universals impact our understanding of what it means to be human. How does the search for Universals help us better understand human cultural behavior? What examples for out own culture can illustrate the ideas that our behaviors are ...
Sunday, May 8, 2011 at 11:48am

biology
14 points Save A photosynthesis experiment uses Chlorella to track the route taken by 14C in photosynthesis. The 14C is provided from CO2 and no new sources of CO2 are available. After the experiment the scientist extracts all of the starch produced and analyses the Carbon ...
Saturday, May 7, 2011 at 9:01am

science - biology
A photosynthesis experiment uses Chlorella to track the route taken by 14C in photosynthesis. The 14C is provided from CO2 and no new sources of CO2 are available. After the experiment the scientist extracts all of the starch produced and analyses the Carbon present. She ...
Saturday, May 7, 2011 at 8:57am

Biology
What are the three types of fibers which comprise the cytoskeleton?
Friday, May 6, 2011 at 2:14pm

Biology
What is combined in the chloroplast to make glucose?
Friday, May 6, 2011 at 2:13pm

biology
Sugar maple trees are tapped in the spring. how far into the tree would you haev to go to tap the syrup?
Thursday, May 5, 2011 at 7:03pm

MATH :)
3. In Biology, it is found that the bacteria in a certain culture double every half-hour. If the initial number of bacteria in culture is 1000, A. Find the defining equation for the number N of bacteria in culture after T hours, assuming that no bacteria die. B. How many ...
Wednesday, May 4, 2011 at 1:34pm

Biology
Which term describes an organism's ability to maintain a stable internal environment? (1) reproduction (2) extinction (3) locomotion (4) regulation
Tuesday, May 3, 2011 at 7:19pm

Biology
What ethical issues might arise when a drug company funds trials of a new drug it has developed to treat a genetic disorder?
Tuesday, May 3, 2011 at 12:34am

Biology
Habitat limits result in a populations A)salinity B) temperature C) physical obstacles D) biogeographic range
Monday, May 2, 2011 at 11:57pm

biology
What is the typical habitat of a human?
Monday, May 2, 2011 at 11:54pm

biology
could you put the following into order from smallest to largest?? DNA GENE CHROMOSOME
Thursday, April 28, 2011 at 10:17pm

biology
The doubling time of a type of bacteria is 35 minutes. If every bacterium reproduces, then after 35 minutes a population of 64 bacteria will have grown approximately to what size?
Thursday, April 28, 2011 at 12:36pm

Biology
A population of animals has a dominant allele for dark-colored fur and a recessive allele for light-colored fur. If the population of animals is 100 and 12 members of the population have the light-colored fur, about what percentage of the population is heterozygous? What ...
Wednesday, April 27, 2011 at 11:46am

biology
in mushrooms,the basisia are found on the
Monday, April 25, 2011 at 9:58pm

biology
To ensure that the mother will have mature egg cells available for in vitro fertiliazation, she must be treated with chemicals that regulate her reproductive cycle. identify these chemicals tha tregulate the female reproductive cycle. Please help me
Sunday, April 24, 2011 at 10:12pm

Pharmacist information
Pharmacists who are trained in the United States must earn a Pharm.D. degree from an accredited college or school of pharmacy. The Pharm.D. degree has replaced the Bachelor of Pharmacy degree, which is no longer being awarded. To be admitted to a Pharm.D. program, an applicant...
Sunday, April 24, 2011 at 7:07pm

biology
explain how mitosis helps an organism to grow.
Sunday, April 24, 2011 at 6:40pm

General Biology
Genetic Inheritance Exercise 1: F1 Hybrid Cross Results: Punnett Square for F1 Cross ¡V Expected Genetic Outcomes F1 Parent, genes: _________ (student to fill in the blanks) ¡ð alleles > ¡ñ alleles v F1 Parent, genes:__________ (student fill in ...
Sunday, April 24, 2011 at 4:22pm

Biology for Kate
I want back and posted something today...about 3 posts back. Let me collect some of the Biology tests online for you. When I get them, I'll post them after this post. Sra
Friday, April 22, 2011 at 6:35pm

Biology
I believe that I have answered the following questions correctly, but would like some reassurance. organisms that are used to decontaminate soils may a. store contaminates in their tissues b. release pollutants into the air c. degrade the pollutants d. be plants or ...
Friday, April 22, 2011 at 5:13pm

Biology
I'm having trouble answering this: The average size of a large fish that humans use for food has been decreasing over time, Exp-lain how, exactly, this happens - be sure to discuss genes, proteins, traits, and selection pressure. This is all I can answer :( The large fish ...
Thursday, April 21, 2011 at 8:36pm

Biology project
THE EVOLUTION OF BARBELLUS Describe the type of food that the diffrent Barbellus spieces might have eaten. 1.caterpillar 2 and 3.type of fish
Wednesday, April 20, 2011 at 10:35pm

biology
a male___________ of an angiosperm is a pollen grain.
Wednesday, April 20, 2011 at 9:42am

Biology
What 'EXPERIMENT' did Craig Venter & Francis Collins do in the Human Genome Project? Any links would be great! I've found a lot of info. on what it is, but I'm looking for info on what they did to get there.
Tuesday, April 19, 2011 at 6:01pm

Human & Social Biology
describe how social biologists may help to solve the problems of housing lacking sanitation
Tuesday, April 19, 2011 at 12:27pm

biology
In every energy transactions, some of the energy is also lost as heat.
Saturday, April 16, 2011 at 1:18am

biology
Explain negative feedback and give one example in the human body.
Friday, April 15, 2011 at 12:22pm

biology
Photosynthetic electron transport, like cellular respiration electron transport, is a series of redox reactions. True False I think it is true.
Friday, April 15, 2011 at 12:21pm

Biology
How does the CVS, urinary and respiratory systems work together to maintain homeostasis?
Thursday, April 14, 2011 at 12:56pm

Biology
Suppose you have monohybrid pea plants in your garden and find that they produce round seeds to wrinkled seeds in the ratio of 3:1. If the alleles are designated R and r, respectively, what are the probable genotypes of the wrinkled seeds produced by your plants?
Thursday, April 14, 2011 at 9:23am

biology
I want to imaging collagen and elastin in porcine heart tissue without staining using a confocal microscopy. So far most of the articles that I found are using staining to differentiate the two, is anyone familiar with the microscopy method
Thursday, April 14, 2011 at 3:47am

Biology
Cellular slime molds begin life as a group of seperate organisms,or individuals.After congregation,they become a single multicellular individual.Describe what is meant by this statement.
Wednesday, April 13, 2011 at 11:46pm

biology
specialized cells in animals are all descended from a single ancestor cell.How are the specialized and the nonspecialized cells of the cellular slime molds related?
Wednesday, April 13, 2011 at 11:34pm

Biology
Distinguish between focal adhesions and adheren junctions, desmosomes and hemidesmosomes , and desmosome and focal adhesions
Wednesday, April 13, 2011 at 4:55pm

biology
when they say collagen content in tissue, what do they mean by "content"
Wednesday, April 13, 2011 at 2:32am

Biology
Where can a find a picture of a sheep's lung with labeled parts?
Tuesday, April 12, 2011 at 10:48pm

Biology
The ability to draw from z specific knowledge and experience to make a general explanation is
Tuesday, April 12, 2011 at 9:29pm

Biology
What are some recent (a few months old would be fine) newspaper articles (found online) about molecular biology? (Eg: cloning, genetically modified food, mutation, etc)
Tuesday, April 12, 2011 at 8:51am

biology
true or false.. 1) A mature pine tree produces either male or female cones (F) 2) Virtually all of our food is derived, directly or indirectly from flowering plants. (T) 3) In vegetative reproduction, new plants may be generated from stems or roots. (F)
Tuesday, April 12, 2011 at 7:49am

biology
why warning coloration has to come before mimicry?
Monday, April 11, 2011 at 10:05pm

biology
DNA breaks apart when the _________ bonds between bases break??
Monday, April 11, 2011 at 9:26pm

biology
if a man is a hetero zygote for a trait but the woman is homozygous recessive, what are the chances that their children will be homozygous dominant
Monday, April 11, 2011 at 9:21pm

biology
Compare and Contrast the following thyroid disorders? 1. IODINE DEFICIENCY a. Does it cause goiter (yes or no) b. Is the metabolic too high or too low? (indicate which) c. Effect on TSH levels (will they increase or decrease?) d. What is the most appropriate way to treat this ...
Monday, April 11, 2011 at 2:43am

biology
Is any one body type better than another?
Sunday, April 10, 2011 at 11:17pm

Biology
what signals the cell to replicate the DNA?
Saturday, April 9, 2011 at 1:12pm

Biology
when dna replicates what happens to the chromosomes.?
Saturday, April 9, 2011 at 1:11pm

Biology
What happens when you need more or faster DNA synthesis?
Saturday, April 9, 2011 at 1:10pm

Biology
Why do you need 3 types of DNA synthesis for a chromosome?
Saturday, April 9, 2011 at 1:09pm

biology
1. Owls sleep during the day and are awake at night because of their kind of estivation habituation* circadian rhythm conditioning 2. When a bird sings to signal others of the same species to keep away, it is showing signs of cheerfulness courtship behavior conditioning ...
Friday, April 8, 2011 at 10:13pm

biology
Which of these dyes/indicators do not have a sulfur atom in them?
Friday, April 8, 2011 at 4:11pm

Biology . Ahh , help me with this question please
summarize how unicellular organisms may have given rise to the first animals ? Please , & thank you(:
Thursday, April 7, 2011 at 7:54pm

biology
You are gardening and accidentally puncture your arm with a nail that was in the soil. No significant occurred but your arm was swollen. Recall that soil contains many microorganisms that could be pathogenic. Describe in detail the nonspecific and specific mechanisms that ...
Thursday, April 7, 2011 at 5:17pm

biology
What is the typical ratio for a dihybrid cross between two parents that are double heterozygotes?
Wednesday, April 6, 2011 at 7:14pm

biology
Explain how alignment of chromosomes on the meta phase plate differs in mitosis, meiosis I, and meiosis II. Why are these arrangements important? Can you tell me where zi can find this information? I don't see it in my text. Thank you
Wednesday, April 6, 2011 at 3:11pm

biology
Hi, I appreciate your expert help,and I have a question for you. If I'm asked to decribe resting potential, action poential, and synaptic transmission,in point form;would the following responses be right? Resting Potential: 1.Membrane at resting potential- negative on the ...
Wednesday, April 6, 2011 at 11:45am

biology
what are examples of enzymatic disorders? How do the diseases involve enzymatic reactions?
Wednesday, April 6, 2011 at 10:40am

Biology HELP
Triaglyceride with three F.A.chains of 20 carbon how to calculate the ATP production Plz show the steps thank you
Tuesday, April 5, 2011 at 10:09pm

Biology 12
Triaglyceride with three F.A.chains of 20 carbon how to calculate the ATP production Plz show the steps thank you
Tuesday, April 5, 2011 at 8:28pm

general biology
why is yeast used in the experiment of respiration?
Tuesday, April 5, 2011 at 1:11pm

Biology
There are many differences between the two major cell types: prokaryotes and eukaryotes. However, the different structures and modes of organization perform basically the same functions. Briefly compare and contrast the different features or functions of prokaryotes and ...
Tuesday, April 5, 2011 at 11:56am

Biology
The gene for fur color in rabbits is an incompletely dominant situation: BB rabbits are brown, Bb rabbits are grey, and bb rabbits are white. The gene for fur color distribution is however co-dominant. This gene, S, has two alleles, S1 and S2; S1S1 animals have stripes only; ...
Tuesday, April 5, 2011 at 8:37am

Biology
In Siberian Huskies base fur color is represented by black & white fur BB, tan/yellow & white fur Bb, and white only fur bb. Siberians all posses two style of fur wire hair (W_) and smooth (ww). What would the genotype and phenotype frequencies be for a true breading white ...
Tuesday, April 5, 2011 at 8:37am

Pages: <<Prev | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | Next>>

Post a New Question | Current Questions

Homework Help: Science

Search
Members