Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

biology
Sketch a mold cell and label the key parts. Include all of the following:  Ribosomes  Mitochondrion  Endoplasmic reticulum  Nucleus  Cell wall  Cell membrane  Golgi apparatus  Vacuole  Centriole

biology
Convert these dates to BP dates (using 1950 as "the present.") Wood fragments from the floor of a palace in Syria - Syro-Hittite period. Date: 675 ± 50 years BCE

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be around ...

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be around ...

Biology science
What is the nature of the phloem vessels after they are stained in the microscopic sections

Biology
State the changes that occur in arterioles in the human skin during thermoregulation

Biology
What's the importance of destination in a mammal

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?

Biology
State the cell theory as we understand it today.

Biology
What is the purpose of control in a scientific experiment.

Biology
1. Why water potential values are negative? 2. Why turgidity is so important for plant cell?

Biology
What are electronic wastes?

Biology
The anticodon for GCG is: A) AUA B) CCT C) UAU D) CGC **D

biology
In Angus cattle, the fur color black (B) is dominant to the color red (b). If we cross a homozygous dominant bull with a homozygous recessive cow is it possible for the offspring to be red?

Biology
1. True or false: even when your research does not support your hypothesis, the hypothesis has value. True False 2. Which one of these could define a "hypothesis?" educated guess conclusion scientific prediction 3. Once you have formulated your hypothesis, you would ...

Biology
what does ribosome mean in simple english?

Biology
Refer to the illustration above.wich point on the graph indicates approximate world population in the year 1950

physics biology chemistry and ict
WHAT ARE THE ALLOTROPES OF ANTIMONY

Advanced Biology
What process is being described" -the manufacture of carbohydrates, fats, and proteins -the taking in of water, food, and ions I cannot find these for the life of me. Thanks in advance.

English
1. The greeks believed that zeus, the king of the gods, lived on mount olympus. 2. The titanic sank after hitting an iceberg off the coast of newfoundland. 3. My cousin collects scandinavian pottery. 4. Stephanie is taking english, math II, and biology. 5. On friday we were ...

biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be? A) gametes B) stem cells C) somatic cells D) epidermal cells

Biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be?

Psychology Final Exam
Check my answers? Thank you, in advance! 1. When we learn to understand the mind and feelings, we can also learn to ________ and _________ behavior. (1 point) predict and control********* understand and explain eliminate and forget explain and describe 2. Phrenology is based ...

biology
1) Gene regulation in eukaryotes a) usually involves in operons b) is simpler than in prokaryotes c) allows for cell specialization d) includes the action of an operator region i think its C can you please explain to me why it is c or why it isnt if i got it wrong? thank you.

biology
A man is heterozygous for two genes (R and L) that are located on different chromosomes. Which of the following processes would result in different combinations of the alleles for these two genes in his sperm? a) fertilization b) independent assortment c) recombination d) ...

biology help
The features listed above describe what type of cell? Unicellular Has a cell wall May have flagella Single chromosome Ribosomes for protein synthesis

Science , Biology
Which creatures live on the energy of the Sun? Angel fish Suquirrel fish Sea urchins Porcupine fish Octopus

Science , Biology
Is Atlantic spadefish Nocturnal or Diurnal? Carnivore, Herbivore, Autotroph? Is Porcupine fish Carnivore, Herbivore, Autotroph? Please give me informationsss!!

Biology
What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.

Biology
Mendel described two important genetic ideas: inheritance of acquired characteristics and the principle of independent assortment. Provide a brief description of what each one means.

Science/Biology/Health and Social Care
What would happen if the body didn't have any energy? I have looked at Anabolism and Catabolism but I am overall, stuck answering this fully.

biology:cells
which of the following is not true? a. ATP is formed during glycolyisis b. ATP contains less potential energy than ADP*** c. Plant cells generate ATP during cellular respiration d. ATP is used as a mobile energy carrier molecule by all cells which of the following is not true...

Science , Biology
Cretaceous extinction... The evidence tells you that “overwhelming evidence suggests that the extinction was caused by a 10-km-diameter asteroid that struck Earth.” Suggest at least three lines of evidence that might have led scientists to this conclusion. Could you please...

Biology
What do plants and algal cells need to produce proteins? Where do plants and again cells get this supple from? THANKS!!!

Cell Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...

Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...

Biology
In a population the proportion of homozygotes in 18 times, the proportion of homozygous recessive. Calculate the frequency of the 2 alleles?

math,physics,chemisty,biology
the number of moles of H2O2 required to completely react with 400ml of 0.5N KMnO4 in acidic medium are

Human and Social Biology
In guinea pigs short hair S,is dominant to long hair. A heterozygous guinea pig mated with a homozygous recessive pure breed. State the proportion of the geno type and the phenotype of the offspring

Biology (please help!!)
Explain the process that takes place in the stroma including and reactants going in nd the products produced from these processes in a. bright sunlight and in b. darkness. c. what happens over an extended period of darkness of many days? What I need to know is part C.. I have ...

biology
Describe how the products of fat digestion enters a person blood?

biology
Why do insects not die if their head is dipped in water

Math
ella took a biology test of 54 question. She got 5/6 with a question correct how many questions did she get wrong on her biology test?

Science, Biology
Can you teach me how should I answer these questions please.. Why the events are significant? First mammals: First primates: First modern humans:

Biology help needed bad!
A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct response to the biologist’s discovery...

Biology
How male circumcion reduces the risk of HIV?

Biology
How is male circumstation reduces the risk of HIV? Explain briefly

Biology
What are 2 advantages for binary fission in bacteria?

Biology
Which of the following best describes the genotypes of the offspring when Mendel crossed true-breeding (pure-breeding) yellow seed plants with true-breeding green seed plants? A) The offspring had a combination of yellow and green seeds. B) The offspring were made up of a ...

biology
How many possible genotypes and phenotypes are there for a single gene trait that shows dominance in any given population?

biology
If the first child of a couple was without dimples, an recessive trait, what is the chance that the second child will be born without dimples? A) 100% B) 25% C) 50% D) Cannot be determined from the phenotype of the child

biology
Which of the following elements is most likely to form an ion that will then form an ionic bond with an ion of a Group 1A element? Be I Fr **my choice Pt

Biology
Has anyone done the effect of cell size on material transport portfolio in Connections academy?

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Biology
In which type of cell does a cell plate form during cytokinesis? a. in plant cells b. in animal cells c. in plants and animals d. in all cells answer: d

Science, Biology
How does DNA encode the characteristics of an organism?

Science Biology
Can you give me a example of Natural Selection?

Science Biology
What does it mean to say that mutations are random?

biology (genetics)
A pure-breeding white mouse with a long tail was crossed to pure-breeding pink mouse with a short tail. The F1 progeny were all pink with long tails. These F1 mice were test crossed to white mouse with a short tail. If the gene controlling color and the gene controlling tail ...

Biology
Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in

Advanced Biology
Hi could you help me with this problem as well? The alleles for red and white coat color in cattle show absence of dominance, the heterozygote being roan. A.In a freely breeding herd of 1000 head how many would you expect to be of each coat color if the allele for white coat ...

Advanced Biology
A recessive lethal gene in chickens causes circulatory failure and death of the embryo at 70 hours.A commercial hatchery finds that a hatching failure due to this gene of greater than 4% is unacceptable.What is the upper limit for the frequency of this allele in the breeding ...

Science, Biology
How did a new species with different variation affect the availability of food for the previously existing species..?

Science , Biology
Why does a sorting process only work when variation is present in a population?

Biology
I need an acrostic poem with the word endomembrane.

Biology
I'm making a study guide for this class and I'm not sure about this question.. can someone give their input? There is another effect that fertilizer had on an aquatic system. What is that called? I think it may be referring to pollution?

biology
someone please help me im confused and idk what im doingg how would i create a dna molecule model using straws, pushpins, and paperclips? help me, please.

Biology
Hi all, Need help with this: What is the difference that you see on a EKG when you have non-transmural MI vs. transmural MI? a) In transmural MI the Q wave is amplified, and the R wave is depleted making the QRS complex look inverted b) In non-transmural, the T wave is absent ...

maths
In a class of 60 students,the number of students who passed biology is 6 more than the number who passed chemistry.Every student passed at least one of the two subjects.i.how many students passed biology ii.how many students passed chemistry iii.how many students passed only ...

biology
Pearl formation is in the syllabus of aipmt or aiims?

9th grade Biology
I really need help with the answers for the unit 2 Lesson 16: Ecology Unit Test

Biology - Lungs
Why are there so many bronchioles in the body?

Biology - DNA
I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these base pairs such as A...

biology
Which of the following is not an organice molecule? Cellulose sucrose water testosterone

biology
which of the following is not an organic compound: cellulose sucrose water testosterone

biology
How to do a Punnett square of a F2 dihybrid cross for peas with the dominant of white flowers over pink and smooth peas over wrinkled peas?

biology
How is a cow protein different than a human protein? How is cow DNA physically different from human DNA? Remember all proteins are made up of amino acids

Biology
A pore whose opening is covered by a diaphragm is clearly visible. What role do the pores serve? What would be the role of the diaphragm?

biology
amino acid is to protein as fat is to lipid DNA is to RNA sugar is to fat simple sugar is to starch

Biology
1. When farming, overgrazing, climate change, and/or seasonal drought change farmland into land that cannot support plant life, it is called (1 point) a. desertification. <- my answer b. depletion. c. deforestation. d. monoculture. 2. Which statement below is NOT true? (1 ...

Biology 20
I'm using chromatography to identify compounds in a leaf extract for a lab, and one of the evaluation questions is 'Suggest a step that could be added to the procedure to isolate a specific compound for chemical testing.' What step could I use?

Biology
A man made allopolyploid ceral crop is?

Biology
In a population of Mendel's garden peas, the frequency of green-flowered plants (genotype aa) is 49%. The population is in Hardy-Weinberg equilibrium. What are the frequencies of the AA and Aa genotypes? I got 9% AA, 42% Aa as my answer, is this correct?

Biology
A consumer can also be considered a a. herbivore b. autotroph c. heterotroph d. primary producer I think the answer is either a or c, because a consumer could also be a herbivore, but I don't know if the question is asking for a different name for a consumer which would be a ...

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...

Biology
Two students were testing the amount of fertilizer that would best promote the growth of tomato plants in a garden. Which of the following could be an unavoidable source of experimental error? Select one: a. variation of tomato plants b. amount of water given to the plants c. ...

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...

Biology
If a curly haired father and straight haired mother 8 children are born .the ratio of curly and straight haired will be ......

urgent mc biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help

urgent mc biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2

multiple choice biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2 Please help

biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help

Biology
Please fill in the blanks : Proteins _____make up the _______ materials , hormones , and enzymes in living things to function correctly .

Biology
6. Consider an experiment in which starch is dissolved in a liter of water. Some of the solution is placed into a securely tied dialysis bag. The dialysis bag is placed into a beaker containing distilled water and iodine for 30 minutes. What are the correct answers for the ...

Maths
In a class of 60students,the number of student passed Biology is 6 more than the number of student passed Chemistry,8 student passed both subject.How many student passed Biology,how many student passed Chemistry,how many student passed only one subject?

biology ms sue
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought* c. after a volcanic eruption, global avarage temperatures lower d. the snow ...

biology
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought c. after a volcanic eruption, global avarage temperatures lower*** d. the snow ...

Biology
Why does humans perceive a red dress as the color red? A- The molecules of the dress do not absorb red light wavelengths B- The molecules of the dress absorb green and blue light wave lengths C- A red dress will primarily absorb red light wave length D A red dress will not ...

Biology
Light absorption by a pigment is measured for red, blue, green, and yellow light.

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>

Homework Help: Science

Post a New Question