Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

Biology
I do not understand what visible and sharp focus mean. The instruction says.... When viewing the crossed hairs and the top hair is in sharp focus, is the other hair visible or in sharp focus at the following total magnification...?

Biology
I do not understand what visible and sharp focus mean. The instruction says.... When viewing the crossed hairs and the top hair is in sharp focus, is the other hair visible or in sharp focus at the following total magnification...?

Biology
organelles with an abundance of carotenoids but no chlorophyll

biology
Covalent bonds are not affected by chemical reactions. true ir false

biology
What are the reactants in the following chemical formula? C6H12O6 + 6O2 ¨ 6CO2 + 6H2O

Biology
What happens when a substance dissolves in the watery solution outside of a cell and equilibrium is disrupted. a. Water from the cell will move into the solution b. water from the solution will move into the cell c. the pores in the cell membrane will become clogged with the ...

Biology
Could someone please explain Endocytosis(phagocytosis, pinocytosis and receptor-mediated endocytosis) in simplest way? I do not understand

Biology 101
1. Which of the following statements is incorrect about homologous chromosomes? a. Homologous chromosomes are similar but not identical b. Homologous chromosomes have the same size and function c. Homologous chromosomes contain genes for the same kind of protein products d. ...

biology
4. Using sunscreen and consuming energy drinks involve _____________________. A. using biological information to make informed decisions B. risks to using biotechnology C. using genomics to make informed decisions D. all of the above

biology
A sheep with human genes spliced into it to produce human antibodies is an example of a(n)

Biology
PLEASE CONSIDER EACH OF THE FOLLOWING CHANGES SEPARATELY. Be sure to enter the sequence using the 3-letter abbreviations (for example, Ala-Gly-Ser), where the left most amino acid of your answer represents the first amino acid of the polypeptide. Another way to say this is: be...

biology
Is carbonic acid (H2CO3) organic or inorganic molecule?

biology
Is carbonic acid (H2CO3) organic or inorganic?

math
the biology class has a lab every days. the earth science class has a lab every three days . which class day do they both have class ?

Biology
Your thermocycler is broken, and can only reach a temperature of 72 degrees Celsius maximum. What effect will this have on your PRC? Will you still get DNA replicated? Explain

Biology
Why wasn't PCR possible until Taq polymerase was discovered?

Biology
In mitosis, if a cell has 4 chromosomes in prophase, how many chromosomes will this cell have in metaphase? a. 64 b. 32 c. 16 d. 8 e. 4 If a cell has 20 chromosomes in G1, how many chromatids will be present during prophase? a. 30 b. 20 c. 5 d. 40 Which of the following ...

biology (Help please!!!)
1. If a student pours a solution of salt water on an elodea leaf, what is it an example of? 2.A child pours salt crystals on the body of a slug he finds in the backyard. Options are: high concentration, low concentration, osmosis, diffusion, hypertonic solution, and hypotonic ...

Biology
Which of the following cells check for during the G2 check point? a. Growth hormone c. DNA integrity b. Nutritional status d. Cell size In mitosis, if a cell has 4 chromosomes in prophase, how many chromosomes will this cell have in metaphase? a. 64 b. 32 c. 16 d. 8 e. 4 The X...

Biology
single celled prokaryotes like the bacteria and archaea are the dominant and most diversified groups of living forms today. does this support their ancient origins? Explain

Biology
I am having a really hard time understanding respiration and photosynthesis. Is there a simple explanation for both processes?

biology
Stuck on this question. When infected by the Hepatitis B virus (HBV), many patients experience flu-like symptoms such as fever, loss of appetite, nausea, vomiting, and malaise. This is called acute hepatitis. During this stage, what is the HBV doing? What do you call this ...

biology need help
3 factors the could produce bias in an experiment

Biology/Chem
Soy sauce is prepared by fermenting a salted mixture of soybeans and wheat with several microorganisms including yeast over a period of 8-10 months. After the solids are removed, the resulting sauce is rich in lactic acid and ethanol. How aere these 2 compounds produced? In ...

need help biology
3 factors the could produce bias in an experiment

biology
3 factors the could produce rats

biology need help
Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...

biology
Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...

biology
Hi there, Not sure the answer for this question. In what way is endospores stronger than bacterial cell?

biology
Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis

biology
What is the sequence of the stop codon?

biology
Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis

cor biology
Substance X has a molar extinction coefficient (E) of 4725 l.mol-1. How many moles of X are needed to produce an absorbance of 1.0 in a 1 ml cuvette?

Biology
The lack of nutrients and molecular building blocks, cells not secreteing materials normally and improper ion balance are results of which organelle not functioning properly

Biology
What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)

Biology
What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)

biology
The frequency of carriers of this disease is 0.02 in a particular population. Consider many couples like 6 and 7 where one parent is affected and the other is unaffected. On average, what is the chance that the first child of these couples will be affected? Please give a ...

Biology
Father has red/green color blindness and is a hemophiliac. Mother is normal. Have two female children (Both are probably carriers). One female offspring marries a normal male. The question is what is the probability that their son is both color blind and hemophiliac? ...

biology 2
The digestive, circulatory, respiratory, immune, and excretory systems all work together to maintain homeostasis. Discuss how a minor malfunction in one of these systems could lead to major malfunctions in others. If methods were developed to improve the efficiency and ...

biology
How does acetocarmine affect chromosomes? We use acetocarmine to stain chromosomes, it gives red color to the chromosomes but HOW can it stain them? How does it color them out of all organelles?

biology
movement of water molecules across the cell membranes from hypertonic to hypotonic solution . whether it is osmosis or diffusion?. please clarify.

biology
is trypsin inhibitor competitive or noncompetitive

Biology of Environment
Im having hard time differentiating b/w inductive and deductive reasoning. In inductive you find patterns, then you reach conclusion, in deductive you reach conclusion based on previous known facts, but i still not quite understand. I also not get the top-down, bottom-up.

Biology of environment
What does dynamic equlibrium population growth mean?

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?

Biology
After adolescence, bones stop growing longer. They do however continue to grow. How do bones remodel and undergo repair

Biology
You wish to produce a human enzyme, protein A, by introducing its gene into bacteria. The genetically engineered bacteria make large amounts of protein A, but it is in the form of an insoluble aggregate with no enzymatic activity. Which of the following procedures might help ...

biology
Which of the following statements is true? 1.Both unicellular and multicellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts. 2.Only multicellular organisms have structures that enable them to regulate ...

biology help plz?????????????????
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...

biology help?
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...

Human and Social Biology
Describe how social biologist may help to solve the the problems of lack of houses a nd problem ooof sanitation

biology
5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not receive any alcohol at ...

Biology simple question
Why is wavelength data important in terms to spectrophotometer. TY SO MUCH!!!

Biology
Caenorhabditis elegans hermaphrodites have six different homologous chromosome pairs: five pairs of autosomes (called I-V) and one pair of sex chromosomes (called X). Hermaphrodites can either self-fertilize or they can be fertilized by males (which only have one X chromosome ...

biology
Briefly explain how the evolution of the pectoral girdle from the aquatic to the terrestrial environment gave rise to muscle differentiation and specialization in relation to the skull.

Biology of environment poster project
We went on field trip as class to a pond and lake and we compared the urban pond with natural lake I'm trying to think of title for this study and title has to contain sufficient detail abt what the study is about and the general location of study it should be complete ...

biology
explain how a pyramid can be used to show the relationship among the organisms in the food web.

biology
How does mitosis in plant cells differ from that in animal cells? A. Animal cells lack a cell plate. B. Plant cells lack centrioles. C. Plant cells lack spindle fibers. D. Animal cells lack cytokinesis. I chose b but I got it wrong please help....

Biology
Glucose + Fructose=__________________. I am thinking it is sucrose or table sugar but I am not sure.

Biology of the environment term
Teacher explained to us what limiting factor was but I'm not able to understand she said that a limiting factor causes increase in population but I not get how and why is called limiting factor than ? She also said how Phodphorus and nitrogen were limiting nutrients ?

Biology
what is taxonomic nomenclature?

biology
This is a Independent and Dependent Variable questions. If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color.

biology
What type of monomer does ATP represent?

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGA​ATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a ...

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(​line(below. The(coding(region((ORF) is(completely(contained(in(the(second(ex​on. Make(sure(you(annotate(the(following(reg​ions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) AATAAA(...

Biology of Environment
Complex systems have multiple sub systems, what would be example of this? A tree?

Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...

biology
I need to know how egg whites would react when tested in iodine and Benedict's solution.

Cell Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...

Biology
Enantiomers, like L-alanine and D-alanine, are so similar that ribosomes will incorporate either one into a protein during synthesis. True or False?

Biology
Which is one way that a freshwater wetland differs from a lake or pond? A. water flows in a lake or pond but never flows in a wetland. B. Wetlands are nesting areas for birds, but lakes and ponds are not. C. Water does not always cover a wetland as it does a lake or pond. D. ...

biology
1.Briefly explain the evolution of limb orientation and the effects of limb posture on support and locomotion. 2.The transition from the aquatic to the terrestrial environment resulted in what kind of evolutionary changes in the girdles of tetrapods? Why might these changes be...

biology
what are the differences between a vein and an artery? Give your answer with reference to specific examples. I don't know how to refer to specific examples...please help me..

biology
Question: How many hydrogens are in this image? Image: oi43.tinypic[dot]com/2hxwql1.jpg (Replace [dot] with a period (.)) Oiriginal Question: (A) Enter the formula for Tamiflu by typing the number of each atom in the blanks. If Tamiflu does not contain any atoms of that ...

biology
A person(between 11-17) gets up and goes somewhere after sitting 20 mins in a place then he stops at a place for his work but a blackish region surrounds his face for 5secs and he falls on the ground ?after 10secs he feels that now his brain is ok and he gets up but with a ...

math
In a survey of 150 students, 90 were taking algebra, and 30 taking biology. a. what is the least number of students who could have been taking both classes? b. what is the greatest number of students who could be taking both courses? c. what is the greatest number of student ...

biology need help
what word is the definition of "all of the populations in a given area." and some examples

Biology ms sue
Hi ms sue you had answerd question abt whether culture ethic have influence over environmental ethics or vice Versa could it be that both have effect over each other ? Why only culture have effect over it ? Cause do environmental ethics change way we perceive environment ?

Biology 101
When we say an atom has an incomplete outer shell, this means the atom has ______________________ electrons in its outermost shell. Atoms that have incomplete outer shells usually seek to fill their shells by forming ____________________ ________________ through the sharing or...

math
In a class of 60 student,the number of student who passed biology is 6 more than the number of student who passed chemistry.Every student passed atleast one of the two subject and 85 student passed both subjects

need help biology
is a community the population in a given area or is that an ecosystem and give ex

Biology of environment
5 factors that influence persons attitude towards environment and how this relate to their own worldview I got media, education and social habits which others ?

Biology of environment
I have to define what these words mean culture and environmental ethics and which one have influence over other For culture I just wrote that its beliefs and customs that are shared of group of people anything to add to that and I don't get what environmental ethic means and ...

Biology of environment
I don't get what these words mean can someone please simplify so I understand thank you !! Anthropocentric Biocentric Ecocentric

BIOLOGY
Can TAMIFLU form a hydrogen bond with another molecule? Can TAMIFLU form a ionic bond with another molecule? Can TAMIFLU form a van der Waals forces bond with another molecule?

biology
what is a descriptive title for an experiment consisting of how alka seltzer dissolves if one is crushed and the other one is whole in warm and cold water?

Biology
Give two examples of each classes of phylum mullusca?

Biology
What is torism? How do echinodermata digest larger prey out side their body?

biology
concentration of methyl mercury in fish and number of meals safely consumed per month which is the dependent and independent does the dependent go on the y or x-axis

biology
3.68kg=____________g

Biology
By what process are molecules absorbed into the large intestine?

biology
Pseudoscience and nonscience differ in that:

biology
Methyl mercury is a toxic substance that can harm the nervous system. Some fish are contaminated with high levels of methyl mercury. In many places, these fish are an important food source. Experiments are being conducted to determine how many meals of contaminated fish can be...

biology
Smithers thinks that a special juice will increase the productivity of workers. He creates two groups of 50 workers each and assigns each group the same task (in this case, they're supposed to staple a set of papers). Group A is given the special juice to drink while they work...

biology
You need a 5 microgram glucose/ml aqueous solution, but the lab balance is accurate to only 0.01g (ie., it displays 2 digits to the right of the decimal point) Describe 2 methods by which you could accurately prepare this solution using the lab balance. I don't know what to do...

Biology
Which of the following is a correct statement? A. Decomposition is an important part of only two of the three nutrient cycles. B. The nutrient cycles contain paths of elements through the living world but not through the nonliving world. C. Living organisms are able to convert...

Science/ biology PLEASE HELP!
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...

Science/Biology
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...

URGENT Science question
Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for this career? biomedical science and meteorology oceanography and paleontology chemistry and biology physics and computer science*** Am I...

  1. Pages:
  2. <<Prev
  3. 9
  4. 10
  5. 11
  6. 12
  7. 13
  8. 14
  9. 15
  10. 16
  11. 17
  12. 18
  13. 19
  14. 20
  15. 21
  16. 22
  17. 23
  18. Next>>

Homework Help: Science

Post a New Question