June 26, 2016

Homework Help: Science: Biology

Recent Homework Questions About Biology

many human-caused losses of biodiversity, such as habitat destruction and of invasive species. are there any natural events that could alter the diversity index?
Friday, November 8, 2013 by chinomso

In humans, short fingers and widow's peak are dominant over long fingers and straight hairline. A heterozygote in both regards reproduces with a similar heterozygote in both regards reproduces with a similar heterozygote. What is the chance of any one child having the ...
Thursday, November 7, 2013 by Iz

What polymers are found commonly in cells? Additionally, what monomers make up those polymers?
Wednesday, November 6, 2013 by rinchan

Enzymes in the human body work in a very wide range of conditions. A. True B. False
Wednesday, November 6, 2013 by hannah

Substance X is converted to substance Y in a chemical reaction. What role would a catalyst play in this scenario? A. It would increase the solubility of substance X into the solvent needed to speed up the reaction. B. It would speed up the reaction by becoming part of the ...
Wednesday, November 6, 2013 by hannah

an experiment, a scientist notices that an enzyme’s catalytic rate decreases when the pH of the environment is changed. Which of the following best summarizes the effect of pH on the enzyme? A. pH changes the shape of the enzyme. B. pH takes energy away from the enzyme, ...
Wednesday, November 6, 2013 by hannah

if there is no oxygen for the glycolysis what process would that be called?
Wednesday, November 6, 2013 by bill

Sulfur has six electrons in its outer most energy level. In ionic bonding, it would tend to ­­­­­­­­​­_____________________________. A. take on two more electrons B. give away two electrons C. give away six electrons D. not take on ...
Wednesday, November 6, 2013 by hannah

Which of the following involve electronic charges? A. hydrogen bonds B. ionic bonds C. polar molecules D. all of the above
Wednesday, November 6, 2013 by hannah

Which of the following involve electronic charges? A. hydrogen bonds B. ionic bonds C. polar molecules D. all of the above
Tuesday, November 5, 2013 by hannah

Sulfur has six electrons in its outer most energy level. In ionic bonding, it would tend to ­­­­­­­­​­_____________________________. A. take on two more electrons B. give away two electrons C. give away six electrons D. not take on ...
Tuesday, November 5, 2013 by hannah

Why is it good for plants on the forest floor to have larger leaves but could be harmful to the trees above?
Tuesday, November 5, 2013 by Joanne

I need help answering this question please. Discuss the influences of biology and the environment on sexual differentiation.
Tuesday, November 5, 2013 by SADE

Biology ms. sue
ms. sue can you give me link to some pictures it says give description of the species including both sexes and their younger life stages for animals include images.
Monday, November 4, 2013 by Mohammad

How do Eukaryotes package their gene products?
Monday, November 4, 2013 by Anonymous

"Quiglilies" are a rare variety of flower. They have one allele for orange petal colour O. They also have another allele for white petals W. These alleles have a co-dominant relationship producing a yellow petal colour. i) what are the possible genotypes and ...
Friday, November 1, 2013 by Kathy

The production of a polypeptide involves the correct sequencing of amino acids, originally encoded by a segment of DNA. This code is transcribed onto mRNA and subsequently translated using tRNA. From the following DNA segment, record the base sequence that would be encoded on ...
Friday, November 1, 2013 by Kathy

What could be a benefit for a plant that can switch between cyclic and non-cyclic electron transport? Think about the products of electron transport and what products are needed for the Calvin Cycle.
Friday, November 1, 2013 by Laurie

How are bryophytes similar to green algae? How are they different?
Thursday, October 31, 2013 by Kailee

What information does relative dating provide?
Thursday, October 31, 2013 by Kailee

if DNA replication were conservative, what sort of bands would you expect from the CsCl density gradient centrifugation?
Thursday, October 31, 2013 by Anonymous

what is one example of a specific case used by scientists for organ cloning?? (therapeutic cloning)
Wednesday, October 30, 2013 by jason

Biology 20
I'm using chromatography to identify compounds in a leaf extract for a lab, and one of the evaluation questions is 'Suggest a step that could be added to the procedure to isolate a specific compound for chemical testing.' What step could I use?
Wednesday, October 30, 2013 by Erika

If a person with Down syndrome marries a person without Down syndrome, is it possible for their child not to have Down syndrome? I assume that there is a 50% chance that they could have a child that will not have down syndrome. Is this correct?
Wednesday, October 30, 2013 by vanessa

grade 11 biology
Consider a germ cell of a person with Down syndrome(Trisomy 21). Explain what is happening with the arrangement of chromosome 21 inside the cell during interphase 1, Anaphase 1, Telophase 1, telophase 11. Please help, I am really stuck on this. Thank you
Wednesday, October 30, 2013 by vanessa

If the axo-membrane becomes more permeable to potassium Ions. What would happen?
Tuesday, October 29, 2013 by Talan. Help!!!!

How does having a large, sweet fruit benefit a plant?
Tuesday, October 29, 2013 by Kailee

Imagine that you collected your data above, threw away the gel, and re-ran PCR again on the same samples, but using a different set of primers. How will the 2nd gel differ from the first since you're using a different set of primers?
Monday, October 28, 2013 by HELP PLEASE

Imagine that you collected your data above, threw away the gel, and re-ran PCR again on the same samples, but using a different set of primers. How will the 2nd gel differ from the first since you're using a different set of primers?
Monday, October 28, 2013 by Anonymous

The primary structure of proteins is often described as "amino acids connected like beads on a string". In this same vein, which of the following images best describes a protein's quaternary structure?
Monday, October 28, 2013 by Anonymous

What would happen if you ran the same sample of DNA as your first experiment but used different primers?
Monday, October 28, 2013 by Help please!

organelles with an abundance of carotenoids but no chlorophyll
Friday, October 25, 2013 by Anonymous

I do not understand what visible and sharp focus mean. The instruction says.... When viewing the crossed hairs and the top hair is in sharp focus, is the other hair visible or in sharp focus at the following total magnification...?
Friday, October 25, 2013 by Anonymous

I do not understand what visible and sharp focus mean. The instruction says.... When viewing the crossed hairs and the top hair is in sharp focus, is the other hair visible or in sharp focus at the following total magnification...?
Friday, October 25, 2013 by Anonymous

organelles with an abundance of carotenoids but no chlorophyll
Friday, October 25, 2013 by Anonymous

Covalent bonds are not affected by chemical reactions. true ir false
Thursday, October 24, 2013 by hannah

What are the reactants in the following chemical formula? C6H12O6 + 6O2 ¨ 6CO2 + 6H2O
Thursday, October 24, 2013 by hannah

What happens when a substance dissolves in the watery solution outside of a cell and equilibrium is disrupted. a. Water from the cell will move into the solution b. water from the solution will move into the cell c. the pores in the cell membrane will become clogged with the ...
Thursday, October 24, 2013 by David

Could someone please explain Endocytosis(phagocytosis, pinocytosis and receptor-mediated endocytosis) in simplest way? I do not understand
Wednesday, October 23, 2013 by will

Biology 101
1. Which of the following statements is incorrect about homologous chromosomes? a. Homologous chromosomes are similar but not identical b. Homologous chromosomes have the same size and function c. Homologous chromosomes contain genes for the same kind of protein products d. ...
Wednesday, October 23, 2013 by Phillip

4. Using sunscreen and consuming energy drinks involve _____________________. A. using biological information to make informed decisions B. risks to using biotechnology C. using genomics to make informed decisions D. all of the above
Wednesday, October 23, 2013 by hannah

A sheep with human genes spliced into it to produce human antibodies is an example of a(n)
Wednesday, October 23, 2013 by hannah

PLEASE CONSIDER EACH OF THE FOLLOWING CHANGES SEPARATELY. Be sure to enter the sequence using the 3-letter abbreviations (for example, Ala-Gly-Ser), where the left most amino acid of your answer represents the first amino acid of the polypeptide. Another way to say this is: be...
Wednesday, October 23, 2013 by youlifex

Is carbonic acid (H2CO3) organic or inorganic molecule?
Wednesday, October 23, 2013 by Mengistu

Is carbonic acid (H2CO3) organic or inorganic?
Wednesday, October 23, 2013 by Mengistu

the biology class has a lab every days. the earth science class has a lab every three days . which class day do they both have class ?
Tuesday, October 22, 2013 by mike

Your thermocycler is broken, and can only reach a temperature of 72 degrees Celsius maximum. What effect will this have on your PRC? Will you still get DNA replicated? Explain
Monday, October 21, 2013 by Anonymous

Why wasn't PCR possible until Taq polymerase was discovered?
Monday, October 21, 2013 by Anonymous

In mitosis, if a cell has 4 chromosomes in prophase, how many chromosomes will this cell have in metaphase? a. 64 b. 32 c. 16 d. 8 e. 4 If a cell has 20 chromosomes in G1, how many chromatids will be present during prophase? a. 30 b. 20 c. 5 d. 40 Which of the following ...
Monday, October 21, 2013 by Paul

biology (Help please!!!)
1. If a student pours a solution of salt water on an elodea leaf, what is it an example of? 2.A child pours salt crystals on the body of a slug he finds in the backyard. Options are: high concentration, low concentration, osmosis, diffusion, hypertonic solution, and hypotonic ...
Sunday, October 20, 2013 by Samantha

Which of the following cells check for during the G2 check point? a. Growth hormone c. DNA integrity b. Nutritional status d. Cell size In mitosis, if a cell has 4 chromosomes in prophase, how many chromosomes will this cell have in metaphase? a. 64 b. 32 c. 16 d. 8 e. 4 The X...
Sunday, October 20, 2013 by John

single celled prokaryotes like the bacteria and archaea are the dominant and most diversified groups of living forms today. does this support their ancient origins? Explain
Sunday, October 20, 2013 by student

I am having a really hard time understanding respiration and photosynthesis. Is there a simple explanation for both processes?
Sunday, October 20, 2013 by Anonymous

Stuck on this question. When infected by the Hepatitis B virus (HBV), many patients experience flu-like symptoms such as fever, loss of appetite, nausea, vomiting, and malaise. This is called acute hepatitis. During this stage, what is the HBV doing? What do you call this ...
Saturday, October 19, 2013 by vanessa

biology need help
3 factors the could produce bias in an experiment
Saturday, October 19, 2013 by loli

Soy sauce is prepared by fermenting a salted mixture of soybeans and wheat with several microorganisms including yeast over a period of 8-10 months. After the solids are removed, the resulting sauce is rich in lactic acid and ethanol. How aere these 2 compounds produced? In ...
Saturday, October 19, 2013 by Drew

need help biology
3 factors the could produce bias in an experiment
Friday, October 18, 2013 by loli

3 factors the could produce rats
Friday, October 18, 2013 by loli

biology need help
Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...
Friday, October 18, 2013 by loli

Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...
Friday, October 18, 2013 by loli

Hi there, Not sure the answer for this question. In what way is endospores stronger than bacterial cell?
Friday, October 18, 2013 by vanessa

Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis
Thursday, October 17, 2013 by loli

What is the sequence of the stop codon?
Thursday, October 17, 2013 by zo

Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis
Thursday, October 17, 2013 by loli

cor biology
Substance X has a molar extinction coefficient (E) of 4725 l.mol-1. How many moles of X are needed to produce an absorbance of 1.0 in a 1 ml cuvette?
Wednesday, October 16, 2013 by Turki

The lack of nutrients and molecular building blocks, cells not secreteing materials normally and improper ion balance are results of which organelle not functioning properly
Wednesday, October 16, 2013 by Alexis

What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)
Tuesday, October 15, 2013 by David

What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)
Tuesday, October 15, 2013 by David

The frequency of carriers of this disease is 0.02 in a particular population. Consider many couples like 6 and 7 where one parent is affected and the other is unaffected. On average, what is the chance that the first child of these couples will be affected? Please give a ...
Monday, October 14, 2013 by bvc

Father has red/green color blindness and is a hemophiliac. Mother is normal. Have two female children (Both are probably carriers). One female offspring marries a normal male. The question is what is the probability that their son is both color blind and hemophiliac? ...
Monday, October 14, 2013 by Frank

biology 2
The digestive, circulatory, respiratory, immune, and excretory systems all work together to maintain homeostasis. Discuss how a minor malfunction in one of these systems could lead to major malfunctions in others. If methods were developed to improve the efficiency and ...
Monday, October 14, 2013 by rayan

How does acetocarmine affect chromosomes? We use acetocarmine to stain chromosomes, it gives red color to the chromosomes but HOW can it stain them? How does it color them out of all organelles?
Sunday, October 13, 2013 by Angora

movement of water molecules across the cell membranes from hypertonic to hypotonic solution . whether it is osmosis or diffusion?. please clarify.
Saturday, October 12, 2013 by ramesh reddy

is trypsin inhibitor competitive or noncompetitive
Saturday, October 12, 2013 by Cristian

Biology of Environment
Im having hard time differentiating b/w inductive and deductive reasoning. In inductive you find patterns, then you reach conclusion, in deductive you reach conclusion based on previous known facts, but i still not quite understand. I also not get the top-down, bottom-up.
Saturday, October 12, 2013 by Mohammad

Biology of environment
What does dynamic equlibrium population growth mean?
Saturday, October 12, 2013 by Mohammad

If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 by Gabby

If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 by Gabby

After adolescence, bones stop growing longer. They do however continue to grow. How do bones remodel and undergo repair
Friday, October 11, 2013 by Gabby

You wish to produce a human enzyme, protein A, by introducing its gene into bacteria. The genetically engineered bacteria make large amounts of protein A, but it is in the form of an insoluble aggregate with no enzymatic activity. Which of the following procedures might help ...
Thursday, October 10, 2013 by Amanda

Which of the following statements is true? 1.Both unicellular and multicellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts. 2.Only multicellular organisms have structures that enable them to regulate ...
Thursday, October 10, 2013 by Cassie

biology help plz?????????????????
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 by sam

biology help?
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 by sam

Human and Social Biology
Describe how social biologist may help to solve the the problems of lack of houses a nd problem ooof sanitation
Tuesday, October 8, 2013 by Michelle

5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not receive any alcohol at ...
Tuesday, October 8, 2013 by hannah

Biology simple question
Why is wavelength data important in terms to spectrophotometer. TY SO MUCH!!!
Monday, October 7, 2013 by Karli

Caenorhabditis elegans hermaphrodites have six different homologous chromosome pairs: five pairs of autosomes (called I-V) and one pair of sex chromosomes (called X). Hermaphrodites can either self-fertilize or they can be fertilized by males (which only have one X chromosome ...
Monday, October 7, 2013 by Marina

Briefly explain how the evolution of the pectoral girdle from the aquatic to the terrestrial environment gave rise to muscle differentiation and specialization in relation to the skull.
Saturday, October 5, 2013 by ami

Biology of environment poster project
We went on field trip as class to a pond and lake and we compared the urban pond with natural lake I'm trying to think of title for this study and title has to contain sufficient detail abt what the study is about and the general location of study it should be complete ...
Friday, October 4, 2013 by Mohammad

explain how a pyramid can be used to show the relationship among the organisms in the food web.
Monday, September 30, 2013 by loli

How does mitosis in plant cells differ from that in animal cells? A. Animal cells lack a cell plate. B. Plant cells lack centrioles. C. Plant cells lack spindle fibers. D. Animal cells lack cytokinesis. I chose b but I got it wrong please help....
Monday, September 30, 2013 by nina

Glucose + Fructose=__________________. I am thinking it is sucrose or table sugar but I am not sure.
Sunday, September 29, 2013 by David

Biology of the environment term
Teacher explained to us what limiting factor was but I'm not able to understand she said that a limiting factor causes increase in population but I not get how and why is called limiting factor than ? She also said how Phodphorus and nitrogen were limiting nutrients ?
Friday, September 27, 2013 by Mohammad

what is taxonomic nomenclature?
Friday, September 27, 2013 by help(in much need)!!!!!!!!!!!!!!!!!!!!

This is a Independent and Dependent Variable questions. If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color.
Thursday, September 26, 2013 by Cheryl

What type of monomer does ATP represent?
Wednesday, September 25, 2013 by biology

The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGA​ATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a ...
Tuesday, September 24, 2013 by aisha

4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(​line(below. The(coding(region((ORF) is(completely(contained(in(the(second(ex​on. Make(sure(you(annotate(the(following(reg​ions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) ...
Tuesday, September 24, 2013 by aisha

Biology of Environment
Complex systems have multiple sub systems, what would be example of this? A tree?
Tuesday, September 24, 2013 by Mohammad

Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Sunday, September 22, 2013 by Cristian

  1. Pages:
  2. <<Prev
  3. 6
  4. 7
  5. 8
  6. 9
  7. 10
  8. 11
  9. 12
  10. 13
  11. 14
  12. 15
  13. 16
  14. 17
  15. 18
  16. 19
  17. 20
  18. Next>>

Homework Help: Science