Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

Biology question plz
Which of the following depends on bacteria? conversion of dead organic matter to fossil fuel photosynthesis dissolution nitrogen fixation I think its A but I feel it could also be D, could you plz help?

Biology
How are RNA bases freed up during transcription to form base pairs?

Biology
During transcription, when RNA nucleotides form base pairs with the DNA template, does this mean that RNA nucleotides and DNA nucleotides pair up?

Biology
If Ms. Brown were serving as a donor, what ABO blood types could receive her blood safely? Ms. Brown has A+ blood type

Biology
Explain how sunlight is the primary source of energy for your own life? Please help!

Biology Help!!!
Describe the relationship between ATP and ADP and the importance of this relationship within a cell. My answer: ATP stands for Adenosine Tri-Phosphate, and is the energy used by an organism in its daily operations. It consists of an adenosine molecule and three inorganic ...

Biology
Why is it necessary to match the donors blood and the recipients blood before a transfusion is given

Biology
What ABO antigens are present on the red blood cells of Mr. Green's blood? Mr. Green Anti A serum - no clump Anti B serum - clump Anti Rh serum - no clump

Biology
What is the role of Helicase in transcription? My textbook says RNA polymerase unzips the DNA during this process, so what does Helicase do?

biology
How do changes in the nucleotide sequence lead to mutations and how could this affect the primary structure of proteins?

Biology
How do you calculate the magnification on a microscope? Please help, I do not have any multiple choice to go by, I have to write a response!

Biology
How do you calculate the magnification on a microscope? Please help, I do not have any multiple choice to go by, I have to write a response!

Biology
A patient has type AB blood. If they received a transfusion of type B blood, predict and explain what would happen

BIOLOGY
What are the possible gametes produced by the individual SsYy?

Biology
A patient has type AB blood. If they received a transfusion of type B blood, predict and explain what would happen

biology
A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?

biology
Which of the following would NOT likely have occurred without the evolution of photosynthetic organisms? A. Life would be much less diverse. B. Most organisms would have gone extinct due to the increase in oxygen. C. Mitochondria-containing cells would not have evolved. D. ...

Biology
Put the following in the correct order. Report results Determine if hypothesis is true Do background research Construct a hypothesis Collect data Analyze results and draw conclusions Design and implement an experiment State the problem / ask questions Correct Order State the ...

Biology
Explain the role of a hypothesis in a scientific investigation

Biology
In terms of energy, what is the difference between glucose and ATP?

Biology
The function of a protein is determined by its ? Answer: shape The shape of a protein is determined by the ? of its ? ? First answer : ? Second two answers : primary structure

Biology
How are the hydrogen bonds broken during DNA replication? Is it done by the DNA polymerases?

chemistry
A Biology student wants to know if Mountain Dew will make plants grow faster than water. As a Chemistry student, you have agreed to assist in the planning of the experiment to make sure the student designs a valid experiment. 1) What is the experimental question? 2) What is ...

Biology
Are a replication fork and an origin of replication the same thing?

Biology
Discribe in details how archaeopteryz sp.was fossilized?

Biology
Describe how you would prepare 90 mL of a 5 mM NaCl solution from a 2 M NaCl stock solution. Describe your actions–exactly what you would do –step-by-step–when preparing this solution. Also show all calculations. Be sure all amounts include units of measurement.

Biology
A student wishes to prepare 300 mL of 0.25 M sucrose. He puts 25.7 g of sucrose in a beaker and then adds 300 mL of dH2O. The total volume of the solution after the sucrose has been dissolved is 330 mL. a) What did he do wrong when preparing his solution? b) What is the actual...

Biology
A company seeks to develop an herbicide that kills plants by directly interfering (at the cellular level) with plants’ ability to maintain turgor pressure. An herbicide could accomplish this by disrupting the membrane of _____.

Biology
A hydrogen ion is the same as a proton true or fasle

Biology
Breaking the hydrogen bond between two water molecules is called dissociation. true or false

Biology
What is a reactant that binds to a catalyst? Answer: a catalyst An enzyme is a kind of ? Answer: a substrate

Biology
What is a reactant that binds to a catalyst? Answer: a catalyst An enzyme is a kind of what? Answer: a substrate

Science - Please Check My Four Answers
Please help me with the following questions: 1. Which is usually the best way to present or communicate inferred data? A. in a bar graph B. in a data table C. in a simple diagram D. in a written paragraph I know the answer isn't C or D(I got C wrong), but now I think the ...

Science - Please Check My Answers
Please help me with the following: Which is usually the best way to present or communicate inferred data? A. in a bar graph B. in a data table C. in a simple diagram D. in a written paragraph I know the answer isn't C or D(I got C wrong), but now I think the answer is B. Is ...

biology
why do potatoes and onions have reducing sugar present

biology
why do potatoes and onions have reducing sugar present.

biology
jordan is doing a science fair project on the effect of music on the growth of tomatoes. he has two tomato plants, plant A and B, that he grows in a window and gives the same amount of water. plant A is exposed to classical music using headphones attached to the soil. ...

Biology
For each of these properties, give an example of how water’s properties affect life on earth. Able to dissolve salt or sugar • unable to dissolve oil • high surface tension (cohesion) • capillary action (cohesion + adhesion) • liquid more dense than solid ice • ...

Science/Biology
In DNA bases, CG is one pair and AT is another pair because the double ring bonds with the single ring. Why can't Guanine bond with Thymine?

Biology
In DNA bases, CG is one pair and AT is another pair because the double ring bonds with the single ring. Why can't Guanine bond with Thymine?

Biology
17.Which one of the following statements is true regarding voluntary and involuntary responses? A.Voluntary responses control the activity of glands. B.Involuntary responses are part of the autonomic system. C.Voluntary responses originate in the sensory receptors. D....

Biology please help!
Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2

Biology
Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2?

Biology - very urgent
Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2?

Biology
What happens to arterial PO2, PCO2, and H+ concentration during moderate excercise? How and why does this stimulate an increase in breathing rate?

Biology
Is respiratory control sensitive to small changes in arterial PO2 or in arterial PCO2?

Biology
I have tried to look this up but can't find it... The basal metabolism rate can be measured by calculating the amounts of _______________ and ______________. (1 point) nitrogen and carbon dioxide nitrogen and oxygen oxygen and carbon dioxide - my guess oxygen and methane

Biology Help
Enzymes: a. increase the amount of energy release in a reaction b. decrease the amount of energy release in a reaction c. catalyze only redox reactions d. reduce the activation energy needed to for a reaction I think its d. or a. Help Please

biology
Q: Analyze an experiment in which one group of plants receive extra fertilizer and another group receives extra water. Is the experiment controlled or uncontrolled? Support your answer. My answer: The experiment is uncontrolled because there is no experiment used for ...

Gr 11 Biology
if you were a snoker, what lung volumes (tidal volume, expiratory reserve volume or vital capacity) would be most affected? i think the answer would be the expiratory reserve volume

Gr 11 Biology
Which person do you think would be more physically fit: a) an individual with a normal expiratory reserve volume and high vital capacity OR B)an individual with a high expiratory reserve volume and normal vital capacity

Biology
How is type 1 diabetes mellitus similar to starvation?

biology
how does light affect anthocyanins?

biology
How could you explain this statement "An ecosystem is constantly changing ,yet it remains the same."

SCIENCE:BIOLOGY>
1. How many seconds do you spend in school during the week (6.5 hours/day)? 2. How many micrograms are in 12 dekagrams? 3. How many centimeters are in 5 kilometers? 4. 3.25 liters are equal to how many kiloliters? 5. how man meters are in 0.65 hectometers? 6. How many grams ...

biology
Suppose that a person inherited an allele of HGD from their father that had the proline 230 to serine mutation and also inherited an allele of HGD from their mother that had the glutamic acid 42 to alanine mutation. What would be that individual’s phenotype? Choose the best...

biology
You have a stock solution that is 350g/L . You perform a 9-fold serial dilution four times. What concentrations will you have in each of your diluted tubes in g/L? (Separate your answers with a comma.)

Biology
PCSK9, a protease that regulates the level of LDL receptors, is a new target for lowering circulating levels of LDL. Excess PCSK9 leads to a decrease in LDL receptor levels. Which one of the following tools would you use in mice to model a potential therapy for humans with ...

Biology
What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...

Biology
What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...

Biology
In a controlled experiment, a scientist is studying how long it takes pea plants growing in different soil types to develop flower buds. What is the manipulated independent variable? a) type of soil used b) number of flower buds produced c) how long it takes for flower buds to...

Biology
Why are most factors held constant in a scientific experiment? Answer: the only part of an experiment that ever changes is the independent variable.

Biology
What is a written observation called? Answer: hypothesis

Biology
Is yeast living, nonliving, or dead? Explain why.

Biology
Compare and contrast the structure and function of a compound light microscope and a scanning electron microscope. Be sure to discuss the structure and function of each as well as the function and usefulness of each when examining a specimen. Please help! I just need help ...

Biology
How would you describe the role that observations and inferences play in the scientific process?

biology
anonyms

biology
Explain how both nucleic acids and proteins are polymers.Be sure to describe the monomers that make up the polymers.

biology
You want to design an experiment to test if a bacteria affects a transmembrane protein. What types of controls should you use to eliminate effects of confounding variables?

biology
Is this correct? 2 examples of reproduction is a starfish and a rose bush....

biology
What are two examples of cellular organization.. Plz help Google sucks 😂

Science
Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for his career? A.biomedical science and meteorology B.oceanography and paleontology C.chemistry and biology D.physics and computer science ...

Science
Which branches of science do pharmacists need knowledge of to do their job properly? A.physics and chemistry B.biology and chemistry C.chemistry and geology D.physics and computer science Is the answer B?

Biology
You are testing the injection of a new chemical on mice to see if it can shrink tumors. To properly administer the chemical, it must be dissolved in water with ascorbic acid (vitamin C) and injected into the middle of a tumor. As a positive control, you plan to similarly ...

Biology
While performing an experiment, a positive control group is given a treatment that was used one time previously in another experiment. This time, however, the positive control does not give the expected result that you received last time. Which of the following is a likely ...

Biology
You want to know if a new species of bacteria we identified (E. glados) has resistance to the antibiotic valinomycin. You make “plates” of LB-agar to culture bacteria on. Some of these are regular LB-agar plates that any bacteria will grow on and others have valinomycin in...

Biology
A "tree of life" explains: a. how organisms are related to each other b. how organisms differ from each other c. the lineages of various organisms. d. All of the above

Biology
Reptiles do not live in the Arctic; however, some birds do, even though they evolved from reptiles. In your own words, offer an explanation for this fact. Include information on the metabolic differences between the two groups' bodies, as well as what effect their metabolic ...

science(biology)
state three secondary functions of roots,stems and leaves

BIOLOGY
A reference calls for the use of "one litre of 0.1 molar acetate buffer pH 5.2” Calculate the amounts of sodium acetate and acetic acid required to make up this buffer, given that for acetic acid Ka = 1.8 x 10-5

biology
during the downpour in a village,the rainwater carried away excess of nitrogenous and other compounds present in the soil to a pond.how will they affect the growth of algae and phyloplankton in the pond?

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?

Biology
Diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct answer on its correct place.

math
In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11

Biology
Suppose that a repressor regulated the expression of the galA gene. Which of the parenthesis would be correct? (((supposing hypothetical bacterium gene: "galA" – encodes an enzyme that is required for cells to digest the sugar galactose/and/ "argB" – encodes an enzyme that...

Biology
Should the point (0,0) be plotted on this graph? Average Temperatures in Degrees F. (1)Jan 52 (2)Feb 57 (3)Mar 65 (4)Apr 73 (5)May 80 (6)June 87 (7)July 89 (8)Aug 88 (9)Sept 82 (10)Oct 73 (11)Nov 63 (12)Dec 55 This data represents a repeating cycle. Should the point (0,0) be ...

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy sequencing ...

biology
If a microscope has a 40× objective lens in place and a 15× eyepiece lens, the magnification of the system under these conditions is

biology
doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

science
doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

biology
so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTG​AAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValT​hrTyr)

Biology
5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

Biology
5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

Biology
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Biology/Help
Which of the following is the purpose of the waxy substance that builds up in the ear canal? A. Insulating the ear canal B. Trapping and removing debris C. Promoting sound conduction D. Cushioning and stabilizing the pinna I thinks it is B

biology, molecular
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Biology
Which of the following will happen if mRNA fails to be translated? A The cell's nucleus will produce more chromatin. B. Ribosomes will not be able to create protein. C. Mitochondria will release ATP. D. The cell will produce more mRNA I think it's B

Biology
Which of the following classes of biomolecules are frequently responsible for bringing about cell differentiation? A Transcription factors B. lnterleukins C. Cytokines D. Nucleotidyl transferases I think it's A

Biology
Which of the following is the purpose of valves in the venous circulatory system? A. Promoting movement of oxygenated blood toward the heart B. Facilitating stasis of blood in the veins C. Propelling blood through the vena cava D. Preventing backward flow of deoxygenated blood...

  1. Pages:
  2. <<Prev
  3. 4
  4. 5
  5. 6
  6. 7
  7. 8
  8. 9
  9. 10
  10. 11
  11. 12
  12. 13
  13. 14
  14. 15
  15. 16
  16. 17
  17. 18
  18. Next>>

Homework Help: Science

Post a New Question