Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

Biology
If the number of ___ in an atom is changed, an ion will be produced. a)proton b)neutron c)electron Could be multiple answers

Biology
if the number of ____ in an atom is changed, it is no longer the same element. a)proton b)neutron c)electron I'm thinking it's A, what do you think? It could be multiple answers, too.

Anthropology
In every culture, cultural constructs will be found. What are the cultural constructs found in the U.S., and how are they used to define gender in society? Compare gender constructs in Pastoralist societies. What differences do you find between the United States and a ...

Biology
I'm trying to find out how regular cells are similar to cancer cells? I have read the chapter 2 times already and the only thing I can come up with is they both divide to make new cells.

Biology
Given 3x10^6 cell/mL in 3mL. Perform dilution calculation so that you can have 1x10^5 cell/200ul. Please help me with this question. Much appreciate.

biology
a category within biology that deals with the physical and chemical functions

Biology: I am really confused.
What is an experiment group and what is a control group? I was thinking an experiment group were people who experiment the world around them out of curiosity.... and that a control group was people who tried to make the world around them better.... is that right?

biology
a biologist prepared a strip of agar (a gelatin- like substance) as shown in the figure below. at position 7, he placed a concentrated sample of amino acid A and at position 1, a concentrated sample of enzyme E. E is known to catalyze the conversion of A to a product P. Assume...

Science plz help
Explain the basic parts of a major theme in molecular biology: the pathway of DNA to RNA to proteins. Include a general idea of what occurs at each stage

Biology
what will the final temperature be of a beaker of water weighing 100g if its initial temperature is 21 ° and is heated using 125 joules in energy?

biology
Suppose you have monohybrid snapdragons in your garden and you find that they produce red seeds to white seeds in the ratio of 3:1. If the alleles are designated R (red seeds) and r (white seeds), what are the probable phenotypes of the parents (P1)?

Biology
What is the result of a cross of a heterozygous curly winged fly to a straight-winged fly? (Include both genotype and phenotype with fractions of each) Do I need to make a monohybrid cross or a dihybrid cross?

Biology
Which of the following is true about DNA? It is a single-stranded molecules Only one of the original DNA strands acts as a template during replication. Both of the original DNA strands act as templates during replication. Its replication takes place in the cytosol.

Biology
Psychics and astrologers are characterized as:

Biology
You have a stock solution of 100mg/100ml methylene blue and you need 6.0 ml of final solution at 2mg/100ml. Design a serial dilution using volumes between 0.1 and 10 ml. Final volume must be 6ml.

Biology
You have a bacterial suspension and you need to dilute it to 0.0010 of the initial concentration so that you can determine the number of colonies per milliliter. The volumes must be between 0.1 and 2 ml. Your final volume must be 1 milliliter.

Biology
You need 25ml of 2% milk solution (v/v. How much milk and water will you need?

Biology
You have been asked to make 200ml of 50% detergent solution (v/v). How would you do it?

Biology
You need to prepare 270ml of a 20% sucrose solution (w/v). Sucrose has a molecular formula of C12H22O11. How would you prepare this solution?

Biology
Is xylem or phloem larger in a plant? My answer is xylem is larger in a plant than phloem.

Civics
In the case The Senate Of Tennessee V. John Thomas Scopes, high school biology teacher John Scopes was accused of teaching content that violated a Tennessee law that stopped public school teachers from teaching evolution. Scopes voted this law , but felt his right to free ...

Chemistry
Can someone please tell me what to expect from Beginner High School chemistry? Is it mostly applying mathematics like physics? Or basically memorizing like biology? Thank you!

Biology
You need to prepare a 0.25 M solution of NaCl but you only need 50 ml of this solution. How many grams of NaCl would you need?

Biology
How many grams of glucose are needed to make 500ml of a 3.0M solution of glucose?

Biology
You need to make 2.5L OF 3M H2SO4. H2SO4 comes as a stock solution in a concentration of 18M. How many ml of stock H2SO4 would you need to make the new solution?

Biology
Are bees and caterpillars apart of kingdom animalia?

Biology
What is the name of the protein that breaks the hydrogen bonds in the double helix causing the DNA strands to separate during DNA replication? I have a test tomorrow so please help!

english
Who can give me a topic for research paper related to marine biology?

english
What is a topic that related to marine biology? And its topical outline?

English
What is a topic that related to marine biology? And its outline?

Biology
If P1 - virgin grey body, long wings female cross with P2 - ebony body vestigial wings male.... how do I figure out what the genotype is? I think it is like this... EVg for female and evg for male... but I honestly have no idea...

Biology
I need to plan a lesson on 'Human Migration' to teach the class. This topic is from B3 GCSE. These are the learning points: ALL: Demonstrate an understanding of the impact of climate change of human behaviour, including: a- The effect of the Ice Age b- Human migration MOST: ...

Biology
How do rocks store oxygen, and how did they come to store them?

Biology
Is saliva(spit) a living thing?

Biology check please
1. Who most influenced Darwin's idea that life could change slowly over a long period of time? (1 point) Malthus Hutton and Lyell Lamarck livestock breeders and farmers 2. Who most influenced Darwin's idea that some offspring are better suited to survival than others? (1 point...

Biology
Monohybrid Cross - crossing one single Trait to _______? Answer: two alleles

Biology
Dominant - an organism with the dominant allele For a trait _________? Answer: that produces the same phenotype Recessive - an organism with the recessive Allele for a trait will __________? Answer : ?

Biology Question
A cell is lacking in its supply of amino acids. Which of the following will occur? A- mRNA will not be formed because enzymes may not be present. B- The ribosomes will not work properly because there will be no proteins. C- tRNA may not be able to fulfill its job. D- all of ...

Biology
Does the electron transport chain part of cellular respiration involve carbon or carbon dioxide?

Biology Help Please
A cell is lacking in its supply of amino acids. Which of the following will occur? A- mRNA will not be formed because enzymes may not be present. B- The ribosomes will not work properly because there will be no proteins. C- tRNA may not be able to fulfill its job. D- all of ...

Biology
A cell is lacking in its supply of amino acids. Which of the following will occur? A- mRNA will not be formed because enzymes may not be present. B- The ribosomes will not work properly because there will be no proteins. C- tRNA may not be able to fulfill its job. D- all of ...

Biology
Photosynthesis and cellular respiration are often described in two ways: (1) they are chemically opposite; and (2) they have a relationship to each other. Explain what these two statements mean. I need help with this please.

^BiOlOgY^
Need Help~How does EXCRETION occur in SNAKES? What iz thier ORGAN ov EXCRETION? What form iz thier excretory waste?

biology
the four children of two parents each have a different blood group of the ABO series.what were the blood groups of the parents explain how?

biology
please explain clearly what is lymphocytes and its funtion?

biology
explain how we understand mendel's experiments?and what is phenotype?

biology
please explain complete process of mitosis and meiosis?

Biology
Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C- ? (What?) -A-A-A-T-G-C- -A-A-G-U-G-C- -G-T-A-G-A-A-C- -A-A-G-G-T-C-

Biology
Which of the following . is true about the DNA molecule during transcription? A- It opens up all of the way, one gene at a time. B- It unwinds from both ends. C- It makes a copy of itself. D- Only a small area is opened. My choice is C.

Biology
Which of the following is one role of RNA polymerase during transcription? A- to break down an already existing protein B- to produce a start sequence C- to build a molecule of mRNA D- to switch uracil with thymine on the exposed gene My choice is C.

biology
Specifically which phases for the Cell Cycle and Meiosis would you see significant differences in? Can someone please help me by explaining this to me?

biology
Which phases are exactly the same for both the Cell Cycle and Meiosis? Can someone please help me with this and explain this to me? Thank you :)

biology
Which phases are exactly the same for both the Cell Cycle and Meiosis? Can someone please help me with this and explain this to me? Thank you :)

Biology
Where does the carbon cycle end? My project asks this, but I can of no specific "ending."

Biology
How does oxygen move in a food chain? When one organism eats another, does the oxygen move from the tissues of the prey to the predator, or is it something different?

biology(really need help!)
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web Are there any ecological issues surrounding the lilac flower(e.g. are its populations decreasing, is it spreading uncontrollably..)

biology
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web Are there any ecological issues surrounding the lilac flower(e.g. are its populations decreasing, is it spreading uncontrollably..)

biology
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web

Biology
In an ecosystem, when energy is given off as heat, does it change forms from chemical substances to heat? Or is it something different?

biology,chemistry,physics
the contact process prepares purest form of sulphuric acid 2so2+o2=2so3 calculate its kp if following concentrations are found at equilibrium so2=0.59,o2=0.05 and so3=0.259

biology
Explain how a new population might be formed

biology
what is the most accepted mechanism for evolution

biology
Explain how a scientist would use DNA or protien sequences taken from three different organisms to create a cladogram

biology
Explain how a scientist would use DNA or protien sequences taken from three different organisms to create a cladogram?

Biology
If there are two sets of 21 chromosomes in a rats lung cell, how many total chromosomes are there in a cell that undergoes mitosis? Answer: 42

Biology
The creation of sex cells occurs in meiosis. Explain what happens when a new organism is created and life begins. Answer: meiosis is a process of cell division that produces sex cells, or gametes. Gametes are reproductive cells such as the sperm and egg. As gametes are ...

Biology
Explain what happens at the first checkpoint If GO is prevented from occuring. Answer: these cells can be called back from the G0 phase to the cell cycle by external cues

Biology
If there are two sets of 21 chromosomes in a rat's lung cell, how many total chromosomes are there in a cell that undergoes mitosis? Answer: 42

Biology
Male donkeys have 62 chromosomes in an eye cell. How many chromosomes would be found in a female donkeys egg? Answer: 62 Normally, pigs have 38 chromosomes in each somatic cell. How many chromosomes are there in a cell that has gone through meiosis? Answer: 19 How many ...

Biology
Ferrets have 40 chromosomes in each heart cell. There are ___ chromosomes in each egg. Answer: 20 If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 Sheep have 27 chromosomes in each cell that had undergone meiosis. How ...

Biology
1. Ferrets have 40 chromosomes in each heart cell. There are ____ chromosomes in each egg. Answer: 20 2. If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 3. Sheep have 27 chromosomes in each cell that has undergone ...

biology
Explain parts of the stem structure in the lilac flower or a flower similar to the lilac flower

biology
I need help finding diagrams of the leaf structure, stem structure and root structure of a lilac flower with explanations. Sites would help

Biology
name three ways somatic cells are different from gamete cells. 1. Gametes are sex cells and are always haploid 2. Somatic cells are non sex cells 3. ?

Biology
explain what would happen if sperm and egg cells were accidentally diploid. If the gametes were not haploid, then the fertilized zygote would have four sets of chromosomes and would probablydie before birth.

Biology
Different types of plants may be angiosperms, vascular seed, vascular non-seed, or non-vascularplants 1) Short grass meadow----I def. know it's not an angiosperm but can it be vascular non-seed 2) Magwort---im debating if it's non-vascular 3) Chokeberry -- def not an ...

Biology quick question
What is the method of nitrogenous waste removal for the following & choose between ammonia, urea or uric acid Tunicates Fishes Amphibians Reptiles Birds Mammals I think tunicates are urea and fishes are ammonia? But please help because I'm not sure and I don't know the rest

Biology
"Emma has difficulty sleeping. Her doctor prescribes Deflex. Deflex is a drug which affects the nervous system. Suggest and explain how Deflex affects the nervous system to help Emma sleep." I have missed a lot of time off of school and I understand how the nervous system ...

Biology quick help
What is the method of nitrogenous waste removal for the following & choose between ammonia, urea or uric acid Tunicates Fishes Amphibians Reptiles Birds Mammals I think tunicates are urea and fishes are ammonia? But please help because I'm not sure and I don't know the rest

Biology
If all of our cells have the same DNA, how come all 23 of our chromosomes are shaped differently?

Biology
What can I write for an assignment that asks me to write about what ecology means to me? I don't know exactly what is meant by "means to you," as in the assignment.

biology
What are some benefits and challenges of being a pharmacologist?

biology
explain the vascular system in the lilac flower.

Biology
If 320 F2 offspring resulted from this F1 cross, how many would be green?

Biology
Based on cellular respiration, what happens when oxygen supply is cut off to an animal?

Biology
what is the vascular system of the lilac flower. i tried finding some sites. some sites would help me. PLease!

biology
Explain the vascular system of a lilac flower Some sites would help me very much as i cant find any that explain the vascular system of the lilac flower.

Biology
Pod color and pod shape were two other traits Mendel was interested in. Set up a dihybrid cross for these two traits. Note: Green pods are dominant over yellow pods and inflated pods are dominant over constricted pods. -Start off with both parents as heterozygotes/hybrids for...

Biology
How is ATP released as heat? Where does the heat go?

Chemical Biology
Which fruits or vegetables or plants do not contain catalase enzyme?

biology
Describe the vascular system and functions of each component of the Lilac flower i tried to find some sites, but i cant find in any. So any sites would help as well

biology
To find out which key will open a lock, you try several until one works. This kind of learning is called ________________________.

biology
phase in photosynthesis during which the energy in sunlight is trapped and converted into ATP and NADPH I need the term for this and cannot find it anywhere. Thanks!

AP Biology
The respiration of plants is a biochemical reaction and should have a rate determined by the Arrhenius equation, k = Ae-EA/RT. Here, k is the rate, A is a constant, EA is the activation energy for the reaction, R is the gas constant, and T is the temperature in kelvins. If the...

biology
which is true about the inside of a cell? -the inside of an animal cell contains structures that carry out specific jobs for the cell, but no water or molecules dissolved in water -the inside of an animal cell contains water, molecules dissolved in the water and structures ...

Biology
Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT​ CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...

Science
For my science (biology) coursework i am doing an experiment involving photosynthesis- the cabomba experiment. I need to know 1- the variables that are controlled and why 2- what equipment is used and why PLEASE HELP... THANK YOU

biology
Amoeba captures food with the help of

Biology
In humans, the allele for brown eyes is dominant to the allele for blue eyes. If a man with blue eyes and a woman with brown eyes who is homozygous for eye color have children, what is the probability of having a child with blue eyes? Here are the choices: 25 percent, 100 ...

Intro Biology
I can't find examples in the book as reference. Please help me with these questions and explain why. 1.) Which of the following has no vascular tissue (“plumbing system”)? A) Conifer B) Angiosperm C) Fern D) Moss E) Ginkgo 2.) Which of the following characteristics of ...

  1. Pages:
  2. <<Prev
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. Next>>

Homework Help: Science

Post a New Question