Wednesday
September 2, 2015

Homework Help: Science: Biology

Recent Homework Questions About Biology

biology
3 factors the could produce rats
Friday, October 18, 2013 by loli

biology need help
Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...
Friday, October 18, 2013 by loli

biology
Which variable does the scientists or you deliberately change? Dependent, Independent, control is is independent Which variable does the scientists measure? Dependent, Independent, control is it dependent 6. Which variable remains the same/constant throughout the experiment? ...
Friday, October 18, 2013 by loli

biology
Hi there, Not sure the answer for this question. In what way is endospores stronger than bacterial cell?
Friday, October 18, 2013 by vanessa

biology
Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis
Thursday, October 17, 2013 by loli

biology
What is the sequence of the stop codon?
Thursday, October 17, 2013 by zo

biology
Evidence suggests that bacteria supplied with a cup of sugar could run a 60-watt light bulb for 17 hours. What would a scientist need to do to be able to affirm this scientific idea? is it to conduct an experiment to test the hypothesis
Thursday, October 17, 2013 by loli

cor biology
Substance X has a molar extinction coefficient (E) of 4725 l.mol-1. How many moles of X are needed to produce an absorbance of 1.0 in a 1 ml cuvette?
Wednesday, October 16, 2013 by Turki

Biology
The lack of nutrients and molecular building blocks, cells not secreteing materials normally and improper ion balance are results of which organelle not functioning properly
Wednesday, October 16, 2013 by Alexis

Biology
What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)
Tuesday, October 15, 2013 by David

Biology
What role do vesicles play in processing the proteins in the Golgi Apparatus? a. They create the proteins.(No) b. They modify the proteins. (No) c. They store the proteins. (Maybe) d.They transport the proteins. (Maybe)
Tuesday, October 15, 2013 by David

biology
The frequency of carriers of this disease is 0.02 in a particular population. Consider many couples like 6 and 7 where one parent is affected and the other is unaffected. On average, what is the chance that the first child of these couples will be affected? Please give a ...
Monday, October 14, 2013 by bvc

Biology
Father has red/green color blindness and is a hemophiliac. Mother is normal. Have two female children (Both are probably carriers). One female offspring marries a normal male. The question is what is the probability that their son is both color blind and hemophiliac? ...
Monday, October 14, 2013 by Frank

biology 2
The digestive, circulatory, respiratory, immune, and excretory systems all work together to maintain homeostasis. Discuss how a minor malfunction in one of these systems could lead to major malfunctions in others. If methods were developed to improve the efficiency and ...
Monday, October 14, 2013 by rayan

biology
How does acetocarmine affect chromosomes? We use acetocarmine to stain chromosomes, it gives red color to the chromosomes but HOW can it stain them? How does it color them out of all organelles?
Sunday, October 13, 2013 by Angora

biology
movement of water molecules across the cell membranes from hypertonic to hypotonic solution . whether it is osmosis or diffusion?. please clarify.
Saturday, October 12, 2013 by ramesh reddy

biology
is trypsin inhibitor competitive or noncompetitive
Saturday, October 12, 2013 by Cristian

Biology of Environment
Im having hard time differentiating b/w inductive and deductive reasoning. In inductive you find patterns, then you reach conclusion, in deductive you reach conclusion based on previous known facts, but i still not quite understand. I also not get the top-down, bottom-up.
Saturday, October 12, 2013 by Mohammad

Biology of environment
What does dynamic equlibrium population growth mean?
Saturday, October 12, 2013 by Mohammad

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 by Gabby

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 by Gabby

Biology
After adolescence, bones stop growing longer. They do however continue to grow. How do bones remodel and undergo repair
Friday, October 11, 2013 by Gabby

Biology
You wish to produce a human enzyme, protein A, by introducing its gene into bacteria. The genetically engineered bacteria make large amounts of protein A, but it is in the form of an insoluble aggregate with no enzymatic activity. Which of the following procedures might help ...
Thursday, October 10, 2013 by Amanda

biology
Which of the following statements is true? 1.Both unicellular and multicellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts. 2.Only multicellular organisms have structures that enable them to regulate ...
Thursday, October 10, 2013 by Cassie

biology help plz?????????????????
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 by sam

biology help?
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 by sam

Human and Social Biology
Describe how social biologist may help to solve the the problems of lack of houses a nd problem ooof sanitation
Tuesday, October 8, 2013 by Michelle

biology
5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not receive any alcohol at ...
Tuesday, October 8, 2013 by hannah

Biology simple question
Why is wavelength data important in terms to spectrophotometer. TY SO MUCH!!!
Monday, October 7, 2013 by Karli

Biology
Caenorhabditis elegans hermaphrodites have six different homologous chromosome pairs: five pairs of autosomes (called I-V) and one pair of sex chromosomes (called X). Hermaphrodites can either self-fertilize or they can be fertilized by males (which only have one X chromosome ...
Monday, October 7, 2013 by Marina

biology
Briefly explain how the evolution of the pectoral girdle from the aquatic to the terrestrial environment gave rise to muscle differentiation and specialization in relation to the skull.
Saturday, October 5, 2013 by ami

Biology of environment poster project
We went on field trip as class to a pond and lake and we compared the urban pond with natural lake I'm trying to think of title for this study and title has to contain sufficient detail abt what the study is about and the general location of study it should be complete ...
Friday, October 4, 2013 by Mohammad

biology
explain how a pyramid can be used to show the relationship among the organisms in the food web.
Monday, September 30, 2013 by loli

biology
How does mitosis in plant cells differ from that in animal cells? A. Animal cells lack a cell plate. B. Plant cells lack centrioles. C. Plant cells lack spindle fibers. D. Animal cells lack cytokinesis. I chose b but I got it wrong please help....
Monday, September 30, 2013 by nina

Biology
Glucose + Fructose=__________________. I am thinking it is sucrose or table sugar but I am not sure.
Sunday, September 29, 2013 by David

Biology of the environment term
Teacher explained to us what limiting factor was but I'm not able to understand she said that a limiting factor causes increase in population but I not get how and why is called limiting factor than ? She also said how Phodphorus and nitrogen were limiting nutrients ?
Friday, September 27, 2013 by Mohammad

Biology
what is taxonomic nomenclature?
Friday, September 27, 2013 by help(in much need)!!!!!!!!!!!!!!!!!!!!

biology
This is a Independent and Dependent Variable questions. If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color.
Thursday, September 26, 2013 by Cheryl

biology
What type of monomer does ATP represent?
Wednesday, September 25, 2013 by biology

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGA​ATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a ...
Tuesday, September 24, 2013 by aisha

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(​line(below. The(coding(region((ORF) is(completely(contained(in(the(second(ex​on. Make(sure(you(annotate(the(following(reg​ions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) ...
Tuesday, September 24, 2013 by aisha

Biology of Environment
Complex systems have multiple sub systems, what would be example of this? A tree?
Tuesday, September 24, 2013 by Mohammad

Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Sunday, September 22, 2013 by Cristian

biology
I need to know how egg whites would react when tested in iodine and Benedict's solution.
Sunday, September 22, 2013 by Em

Cell Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Saturday, September 21, 2013 by Cristian

Biology
Enantiomers, like L-alanine and D-alanine, are so similar that ribosomes will incorporate either one into a protein during synthesis. True or False?
Saturday, September 21, 2013 by Liam

Biology
Which is one way that a freshwater wetland differs from a lake or pond? A. water flows in a lake or pond but never flows in a wetland. B. Wetlands are nesting areas for birds, but lakes and ponds are not. C. Water does not always cover a wetland as it does a lake or pond. D. ...
Tuesday, September 17, 2013 by Cassie

biology
1.Briefly explain the evolution of limb orientation and the effects of limb posture on support and locomotion. 2.The transition from the aquatic to the terrestrial environment resulted in what kind of evolutionary changes in the girdles of tetrapods? Why might these changes be...
Monday, September 16, 2013 by ami

biology
what are the differences between a vein and an artery? Give your answer with reference to specific examples. I don't know how to refer to specific examples...please help me..
Sunday, September 15, 2013 by Zi

biology
Question: How many hydrogens are in this image? Image: oi43.tinypic[dot]com/2hxwql1.jpg (Replace [dot] with a period (.)) Oiriginal Question: (A) Enter the formula for Tamiflu by typing the number of each atom in the blanks. If Tamiflu does not contain any atoms of that ...
Sunday, September 15, 2013 by HYDROGEN COUNT

biology
A person(between 11-17) gets up and goes somewhere after sitting 20 mins in a place then he stops at a place for his work but a blackish region surrounds his face for 5secs and he falls on the ground ?after 10secs he feels that now his brain is ok and he gets up but with a ...
Saturday, September 14, 2013 by satyajit

math
In a survey of 150 students, 90 were taking algebra, and 30 taking biology. a. what is the least number of students who could have been taking both classes? b. what is the greatest number of students who could be taking both courses? c. what is the greatest number of student ...
Saturday, September 14, 2013 by math student

biology need help
what word is the definition of "all of the populations in a given area." and some examples
Friday, September 13, 2013 by loli

Biology ms sue
Hi ms sue you had answerd question abt whether culture ethic have influence over environmental ethics or vice Versa could it be that both have effect over each other ? Why only culture have effect over it ? Cause do environmental ethics change way we perceive environment ?
Friday, September 13, 2013 by Mohammad

Biology 101
When we say an atom has an incomplete outer shell, this means the atom has ______________________ electrons in its outermost shell. Atoms that have incomplete outer shells usually seek to fill their shells by forming ____________________ ________________ through the sharing or...
Friday, September 13, 2013 by Sam

math
In a class of 60 student,the number of student who passed biology is 6 more than the number of student who passed chemistry.Every student passed atleast one of the two subject and 85 student passed both subjects
Thursday, September 12, 2013 by Daniel

need help biology
is a community the population in a given area or is that an ecosystem and give ex
Thursday, September 12, 2013 by loli

Biology of environment
5 factors that influence persons attitude towards environment and how this relate to their own worldview I got media, education and social habits which others ?
Thursday, September 12, 2013 by Mohammad

Biology of environment
I have to define what these words mean culture and environmental ethics and which one have influence over other For culture I just wrote that its beliefs and customs that are shared of group of people anything to add to that and I don't get what environmental ethic means ...
Thursday, September 12, 2013 by Mohammad

Biology of environment
I don't get what these words mean can someone please simplify so I understand thank you !! Anthropocentric Biocentric Ecocentric
Thursday, September 12, 2013 by Mohammad

BIOLOGY
Can TAMIFLU form a hydrogen bond with another molecule? Can TAMIFLU form a ionic bond with another molecule? Can TAMIFLU form a van der Waals forces bond with another molecule?
Thursday, September 12, 2013 by Tom Sonoa

biology
what is a descriptive title for an experiment consisting of how alka seltzer dissolves if one is crushed and the other one is whole in warm and cold water?
Wednesday, September 11, 2013 by loli

Biology
Give two examples of each classes of phylum mullusca?
Wednesday, September 11, 2013 by Goshi G. Aondofa

Biology
What is torism? How do echinodermata digest larger prey out side their body?
Wednesday, September 11, 2013 by Goshi G. Aondofa

biology
concentration of methyl mercury in fish and number of meals safely consumed per month which is the dependent and independent does the dependent go on the y or x-axis
Tuesday, September 10, 2013 by loli

biology
3.68kg=____________g
Monday, September 9, 2013 by austin

Biology
By what process are molecules absorbed into the large intestine?
Monday, September 9, 2013 by Anonymous

biology
Pseudoscience and nonscience differ in that:
Saturday, September 7, 2013 by Anonymous

biology
Methyl mercury is a toxic substance that can harm the nervous system. Some fish are contaminated with high levels of methyl mercury. In many places, these fish are an important food source. Experiments are being conducted to determine how many meals of contaminated fish can be...
Friday, September 6, 2013 by loli

biology
Smithers thinks that a special juice will increase the productivity of workers. He creates two groups of 50 workers each and assigns each group the same task (in this case, they're supposed to staple a set of papers). Group A is given the special juice to drink while they ...
Thursday, September 5, 2013 by loli

biology
You need a 5 microgram glucose/ml aqueous solution, but the lab balance is accurate to only 0.01g (ie., it displays 2 digits to the right of the decimal point) Describe 2 methods by which you could accurately prepare this solution using the lab balance. I don't know what ...
Wednesday, September 4, 2013 by alex

Biology
Which of the following is a correct statement? A. Decomposition is an important part of only two of the three nutrient cycles. B. The nutrient cycles contain paths of elements through the living world but not through the nonliving world. C. Living organisms are able to convert...
Wednesday, September 4, 2013 by Cassie

Science/ biology PLEASE HELP!
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 by Pam (please help)

Science/Biology
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 by Pam

URGENT Science question
Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for this career? biomedical science and meteorology oceanography and paleontology chemistry and biology physics and computer science*** Am I...
Tuesday, September 3, 2013 by Gabby

Please Help Biology Question
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 by Pam

Biology (Please Help: Urgent)
The Hardy-Weinberg formulas allow scientists to determine whether evolution has occurred. Any changes in the gene frequencies in the population over time can be detected. The law essentially states that if no evolution is occurring, then an equilibrium of allele frequencies ...
Friday, August 30, 2013 by Joy

Biology
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in rhe blood plasma. ...
Wednesday, August 28, 2013 by Talan

Biology
Which of the following is true? A.Biased thinking promotes scientific ideas. B.Open-mindedness restricts scientific thinking. C. Creativity fosters scientific discovery. D. Skepticism inhibits scientific exploration. I think it is C...?
Wednesday, August 28, 2013 by Cassie

Biology
Describe how enzymes affect chemical reactions and explain why this makes enzymes important to living things. I need help this will be on my test I am studying for.
Wednesday, August 28, 2013 by Scott

Biology
Amino acid is to protein as A. fat is to lipid B. DNA is to RNA C. sugar is to fat D. simple sugar is to cellulose I think it is A..?
Wednesday, August 28, 2013 by Cassie

Biology
You are testing a hypothesis that population density of a particular plant species influences the rate at which a pathogenic fungus infects the plant. Because the fungus causes visible scars on the leaves, you can easily determine whether a plant is infected. Design an ...
Monday, August 26, 2013 by Anon

biology
Does each sister chromatid contain double stranded DNA?
Sunday, August 25, 2013 by loue

Biology
What does the notation 4n = 28 tell you about how many types of chromosomes there are and how many of each type of chromosome are present in a cell? I am a little confused on how this is determined. Would it be 4 sets of chromosomes with 7 of each type of chromosome?
Saturday, August 24, 2013 by Zach

Biology
1. Given the following concordance rates, is the identified trait primarily genetic or environmental? Explain. MZ Twins DZ Twins Height 0.94 0.44 Measles 0.95 0.87 Migraine headaches 0.80 0.39 Body fat percentage 0.73 0.22
Thursday, August 22, 2013 by Susan

Biology
The intracellular fluid concentration is 300 mOsm/kg. The extracellular fluid concentration is 280 mOsm/kg. The net movement of water is in which direction?
Wednesday, August 21, 2013 by Susan

Biology
The intracellular fluid concentration is 300 mOsm/kg. The extracellular fluid concentration is 280 mOsm/kg. The net movement of water is in which direction?
Wednesday, August 21, 2013 by Susan

Biology (Science)
Which of the following is not true about a hypothesis? 1) Previous knowledge can help support it. 2) It is a tentative explanation. 3) It can be proven to be false. 4) It must be testable to be useful. 5) It can be proven to be true. I know for sure that 2 and 4 is not the ...
Wednesday, August 21, 2013 by Sarah

Biology (Science)
John uses mechanical "predators" to approach frogs at a pond shore, and he records the distance between predator and frog as the frogs jump. (PEER REVIEW) On a walk around pond John sees that small frogs on the shore only allow him to get within 5 feet before jumping...
Wednesday, August 21, 2013 by Sarah

Biology
Draw a Punnett square to demonstrate the inheritance of cystic fibrosis with both parents being carriers
Tuesday, August 20, 2013 by Susan

biology
which of the following properties of water would be most important in protecting a fish in a shallow pond on a hot summer day?
Tuesday, August 20, 2013 by Victoria

BiologyI
Discoveries in DNA, cell biology, evolution, biotechnology have been among the major achievements in biology over the past 200 years with accelerated discoveries and insights over the last 50 years. Consider the progress we have made in these areas of human knowledge. Present ...
Monday, August 19, 2013 by michael R

Biology
The father of a mating pair expresses Huntington disease. The mother is healthy. What is the recurrence risk for the offspring? Draw a Punnett square to demonstrate the inheritance.
Sunday, August 18, 2013 by Susan

Biology
Which of the following statements about the compound HCl is true? *The physical and chemical properties of HCl are different from those of H2 and Cl2. *Only the physical properties of HCl are different from those of H2 and Cl2. *Only the chemical properties of HCl are ...
Thursday, August 15, 2013 by Cassie

biology
identify and describe how organism could respond to an external stimulus
Wednesday, August 14, 2013 by Paula

Biology please help
1. Contraction of the diaphragm causes: A. a person to exhale. B. the size of the chest cavity to increase. C. air to flow from the lungs to the outside. D. compression of the lungs. is it B 2. The function of the large intestine is to: A. supply enzymes for digestion. B. ...
Saturday, August 10, 2013 by Amy

Biology
1. Muscles are grouped in antagonistic sets because: A. muscles cannot lengthen by themselves. B. muscles push but cannot pull. C. they do not like one another. D. there is an increase in metabolic efficiency if they are present in antagonistic sets. is it A 2. In most women&#...
Saturday, August 10, 2013 by Amy

Biology
1. Contraction of the diaphragm causes: A. a person to exhale. B. the size of the chest cavity to increase. C. air to flow from the lungs to the outside. D. compression of the lungs. is it B 2. The function of the large intestine is to: A. supply enzymes for digestion. B. ...
Saturday, August 10, 2013 by Amy

Biology
1. Unprotected seeds are found in: A. cones. B. perfect flowers. C. imperfect flowers. D. fruit. im confused between A n D 2. The most harmful parasite for plants and animals is the: A. roundworm. B. protozoan. C. fungus. D. flatworm. is it A 3. Benthic organisms are found: A...
Tuesday, August 6, 2013 by Amy

biology- photosynthesis
There is a distinct oscillation of CO2 during each year as CO2 is added to the atmosphere each winter or removed from the atmosphere each summer. Explain what specific cellular processes lead to these changes in CO2 level. You must explain what causes CO2 to be released to the...
Tuesday, August 6, 2013 by alex

  1. Pages:
  2. <<Prev
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. Next>>

Homework Help: Science

Members