August 21, 2014

Homework Help: Science: Biology

Recent Homework Questions About Biology

Post a New Question | Current Questions

Reptiles do not live in the Arctic; however, some birds do, even though they evolved from reptiles. In your own words, offer an explanation for this fact. Include information on the metabolic differences between the two groups' bodies, as well as what effect their ...
Monday, August 18, 2014 at 12:46pm

state three secondary functions of roots,stems and leaves
Sunday, August 17, 2014 at 6:32pm

A reference calls for the use of "one litre of 0.1 molar acetate buffer pH 5.2” Calculate the amounts of sodium acetate and acetic acid required to make up this buffer, given that for acetic acid Ka = 1.8 x 10-5
Saturday, August 16, 2014 at 6:36am

during the downpour in a village,the rainwater carried away excess of nitrogenous and other compounds present in the soil to a will they affect the growth of algae and phyloplankton in the pond?
Thursday, August 14, 2014 at 7:47am

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?
Wednesday, August 13, 2014 at 12:34pm

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?
Wednesday, August 13, 2014 at 12:30pm

Diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct answer on its correct place.
Tuesday, August 12, 2014 at 3:01pm

In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11
Sunday, August 10, 2014 at 4:20pm

Suppose that a repressor regulated the expression of the galA gene. Which of the parenthesis would be correct? (((supposing hypothetical bacterium gene: "galA" – encodes an enzyme that is required for cells to digest the sugar galactose/and/ "argB" &#...
Saturday, August 9, 2014 at 11:06am

Should the point (0,0) be plotted on this graph? Average Temperatures in Degrees F. (1)Jan 52 (2)Feb 57 (3)Mar 65 (4)Apr 73 (5)May 80 (6)June 87 (7)July 89 (8)Aug 88 (9)Sept 82 (10)Oct 73 (11)Nov 63 (12)Dec 55 This data represents a repeating cycle. Should the point (0,0) be ...
Thursday, August 7, 2014 at 5:19pm

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...
Thursday, August 7, 2014 at 6:44am

If a microscope has a 40× objective lens in place and a 15× eyepiece lens, the magnification of the system under these conditions is
Wednesday, August 6, 2014 at 2:47pm

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 seperate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...
Wednesday, August 6, 2014 at 8:33am

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 seperate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...
Tuesday, August 5, 2014 at 7:17pm

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTG​AAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValT​hrTyr)
Tuesday, August 5, 2014 at 11:52am

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and ...
Monday, August 4, 2014 at 3:45pm

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and ...
Monday, August 4, 2014 at 3:45pm

Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5&#...
Monday, August 4, 2014 at 3:43pm

Which of the following is the purpose of the waxy substance that builds up in the ear canal? A. Insulating the ear canal B. Trapping and removing debris C. Promoting sound conduction D. Cushioning and stabilizing the pinna I thinks it is B
Wednesday, July 30, 2014 at 12:57pm

biology, molecular
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5&#...
Wednesday, July 30, 2014 at 11:09am

A scientist has noted a possible relationship between a certain chemical substance found in fish and the occurrence of kidney failure in humans. Which of the following preliminary steps should the scientist take before conducting a controlled experiment? A. Establish a cause ...
Sunday, July 27, 2014 at 5:04pm

Which of the following will happen if mRNA fails to be translated? A The cell's nucleus will produce more chromatin. B. Ribosomes will not be able to create protein. C. Mitochondria will release ATP. D. The cell will produce more mRNA I think it's B
Sunday, July 27, 2014 at 5:00pm

Which of the following classes of biomolecules are frequently responsible for bringing about cell differentiation? A Transcription factors B. lnterleukins C. Cytokines D. Nucleotidyl transferases I think it's A
Sunday, July 27, 2014 at 4:58pm

Which of the following is the purpose of valves in the venous circulatory system? A. Promoting movement of oxygenated blood toward the heart B. Facilitating stasis of blood in the veins C. Propelling blood through the vena cava D. Preventing backward flow of deoxygenated blood...
Sunday, July 27, 2014 at 4:58pm

In an experiment, a researcher counts the number of oxygen bubbles produced by water plants placed under different colors of light. The researcher finds that water plants placed under white light release more oxygen bubbles than water plants placed under red light. Which of ...
Sunday, July 27, 2014 at 4:57pm

A researcher collects high-resolution photographs of the Earth taken from outer space at annual intervals for the last decade. This data would be most useful to analyze which of the following? A. Human movement during crises B. Migration patterns of large whales C. ...
Saturday, July 26, 2014 at 3:23pm

Mutations during which of the following processes in animals will affect offspring of succeeding generations? A Meiosis B. Mitosis C. Translation D. Transcription I think A!
Thursday, July 24, 2014 at 3:17pm

Biology/ a&p
Which of the following parts of the circulatory system carries oxygenated blood? A. An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...
Thursday, July 24, 2014 at 3:02pm

Which of the following represents Boyle's gas law? A. Gas turns to a liquid when temperature reaches 0° C (32° F). B. As the volume of a gas increases, the temperature also increases. C. At any temperature, inert gases are less combustible than non-inert gases. D. ...
Thursday, July 24, 2014 at 10:49am

Which of the following processes produces haploid gametes? A. Meiosis B. Fertilization C. Mitosis D. In!@#$%^&tion I think A
Wednesday, July 23, 2014 at 9:23pm

6. If each of eight biology classrooms is in use for 5 hours and 15 minutes per day, and total of 84 student experiments are done, how long does each experiment take on average? A.20 minutes B.30 minutes C. 40 minutes D.50 minutes E.1 hour please show work.
Wednesday, July 23, 2014 at 7:33pm

1. Giraffes have long necks that allow them to reach more food sources in their habitat. The long neck trait is an example of A. selection. B. adaptation. C. radiation. D. homology. 2. Which of the following is the most common kind of chemical bond in biological molecules? A. ...
Wednesday, July 23, 2014 at 6:54pm

Is emulsification chemical or mechanical?
Wednesday, July 23, 2014 at 2:59am

Which of the following is the balanced equation for photosynthesis in plant cells? A 3C0+ 3H0 + Energy --)-CH120 + 30 2 266 2 B. 6C0+ 6Hp + Energy--)-CHp + 60 2 616 2 C. CH0 + 30--)-3C0+ 3H0 + Energy 6126 2 2 2 D. CHp + 60--)-6C0+ 6Hp + Energy 616 2 2 I really do not know
Monday, July 14, 2014 at 7:30pm

. Which of the following parts of the circulatory system carries oxygenated blood? A An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...
Monday, July 14, 2014 at 7:27pm

. The covalent bonds between the monomers of an enzyme macromolecule are A. glycosidic bonds. B. peptide bonds. C. phosphodiester bonds. D. ester bonds. I thimk it is B
Sunday, July 13, 2014 at 3:47pm

. Which of the following is the term given to the sequence of nucleotides that contains the information to make a specific protein molecule? A. Promoter B. Gene C. Operator D. Locus I thinh it is B.
Sunday, July 13, 2014 at 3:25pm

Plant -+ Deer --+ Tiger The first step in the energy chain that created the bonds of proteins in the tiger's muscle cells in the food chain shown above is the A. deer the tiger ate. B. plant the deer ate. C. photons the sun made. D. carbohydrates the plant made. I think it...
Sunday, July 13, 2014 at 12:10pm

Which of the following terms describes changes in allele frequencies in the gene pool over a single generation? A. Macroevolution B. Microevolution C. Segregation D. Speciation
Sunday, July 13, 2014 at 11:43am

. Which of the following is an appropriate description of the arrangement of the cell membrane? A. Fluid phospholipid bilayer containing embedded proteins B. Rigid carbohydrate bilayer containing embedded phospholipids C. Rigid layer of phospholipids with proteins on the outer...
Sunday, July 13, 2014 at 11:38am

You have discovered a new species of yeast and you would like to determine the pathway that this organism uses to synthesize the amino acid tryptophan. This yeast species can take up tryptophan, or synthesize it on its own if tryptophan is not present in the environment. ...
Friday, July 11, 2014 at 3:16pm

chemistry, biology
Calculate the pH of a solution obtained by adding 20 mL of .2M KOH to 480 mL to .02M isoelectric glycine
Sunday, July 6, 2014 at 11:25pm

give an article of 100 words on cardiac attack
Saturday, July 5, 2014 at 7:15am

How animal cells compensate the function performed by vacuoles in plant?
Friday, July 4, 2014 at 1:28pm

Give an account of different components of nucleus and also mention their function?
Friday, July 4, 2014 at 1:19pm

Mention the role of DNA and RNA in living organisms?
Friday, July 4, 2014 at 1:13pm

Why do the primitive organisms have lesser number of cells as compared to more advanced forms?
Friday, July 4, 2014 at 1:09pm

Water boils at a higher temperture than a non-polar solvent like either because?
Friday, July 4, 2014 at 12:10pm

My textbook says human blood is cooled to 0 degree celsius before haemodialysis .I am wondering why?
Sunday, June 29, 2014 at 5:24am

does dark reaction helps in transmittance and conservation of energy
Thursday, June 26, 2014 at 8:12am

Today many different species of tortoise may be found in he Galapagos islands. Using your knowledge of evolution, explain how these many specues arose from one common ancestor?
Wednesday, June 18, 2014 at 10:19am

Discuss the concept of species. What ways do modern taxonomists use to distinguish different species?
Tuesday, June 17, 2014 at 3:42pm

what does the following carry. 1.artery 2.vein 3.pulmonary artery. 4.pulmonary vein 5.right auricle 6.right ventricle. 7.left auricle 8.left ventricle
Monday, June 16, 2014 at 12:22pm

A bacterial strain divides once every 30 minutes. After 90 minutes, a single bacterium can form a total of ___ bacteria
Monday, June 9, 2014 at 2:04am

What would happen if a nucleotide was deleted in the exon region of a gene? the intron?
Monday, June 9, 2014 at 12:04am

What are the similarities between virus and retrovirus?
Thursday, June 5, 2014 at 3:00pm

What are the similarities between capsid and prion?
Thursday, June 5, 2014 at 3:00pm

What are the similarities between Prion and virus?
Thursday, June 5, 2014 at 2:57pm

How much heat is needed to raise the temperature of 20g of copper from 20 degrees celcius to 40 degrees celcius? (The specific heat of copper is 385J/Kg degrees celcius)
Thursday, June 5, 2014 at 1:59pm

if a population comprised 52 AA, 114 Aa and 34 aa individuals and the 'A' allele was dominant, what would be the genotype, allele, and phenotype frequencies be
Tuesday, June 3, 2014 at 1:05am

1. Dante loves swimming but he wants to improve his arm strength. He researches kayaking and decides to participate in this activity. Which location would provide him the best location for training? A. swimming pool B. ocean with friends C. local river with a trained kayaker...
Monday, June 2, 2014 at 3:19pm

biology Please Help
The probability that their baby will be a carrier of the gene for PKU is (A) __________. The probability that their baby will be affected by PKU is (B) __________. If both genotypes were Pp, the probability that their baby would be affected by PKU would be (C) _________. my ...
Sunday, June 1, 2014 at 12:50am

How does insulin and glycogen help maintain homeostasis in one's body ?
Saturday, May 31, 2014 at 11:09am

If two different people use the same dichotomous key to identify the same organism, should they have different results? Explain. ( 3 points ) I put: They should have the same results. Since they are using the same key, the results couldn't possibly change. Anything else I ...
Thursday, May 29, 2014 at 6:14pm

biology plz help
Holly knows from talking with Renee that genes control traits and are determined by the sequence of nucleotides. When that sequence of nucleotides is altered for some reason during DNA replication, it can lead to the gene being expressed in a different way or to a genetic ...
Tuesday, May 27, 2014 at 9:44pm

Simple Biology
A majority of scientists worldwide agree with a new theory of evolution proposed by a group of students. The theory will most likely be (2 points) rejected. accepted. non-testable. non-observable. *I think it is B, but I am not sure
Saturday, May 24, 2014 at 9:27pm

biology honors
i am doing a research paper on animal rights what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "animals used as experiments") my thesis is animals should not be used as ...
Saturday, May 24, 2014 at 9:53am

Biology Please help
There are several genes that control eye color; eye color is therefore called a (A) Polygenic trait. Besides genes that directly control eye color, there are other genes that can affect the color of your eyes. For example, your eye color genes may code for green eyes, but if ...
Friday, May 23, 2014 at 11:24pm

biology honors
i am doing a research paper on cancer. what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "the good and bad of cancer"
Friday, May 23, 2014 at 9:27pm

Biology 30
In what size populations might you expect it to be relatively common for alleles to become fixed? Why? I think that larger populations would be more likely to have fixed alleles, since perfect Hardy-Weinberg equilibrium states that there will be no change in allele frequency ...
Friday, May 23, 2014 at 7:50pm

human biology
If type B blood was accidentally given to someone with Type O blood, a defense response called (A)__________ would occur. This is because the type O person has A and B defensive proteins called (B)__________ that would mount a defense against the type B blood, causing clumping.
Thursday, May 22, 2014 at 5:22pm

14. The layer of skin that contains nerves and blood vessels is the _________ 15. ________ digestion occurs in the small intestine through the action of enzymes. 16. Urea, excess water, and other waste materials are eliminated in a water fluid called ______________. 17. ...
Thursday, May 22, 2014 at 12:06pm

Human immunodeficiency virus (HIV), the virus that causes AIDS, is unique because its main genetic instructions are in the form of RNA instead of DNA. Because of this, it’s called a(n) (A) __________. When a person is infected with HIV, the immune system mounts a normal ...
Thursday, May 22, 2014 at 12:20am

BIOLOGY please help
The first phase of somatic cell division is (A) __________, when the cell’s chromosomes condense, and the nuclear envelope that holds the chromosomes starts to break up. During this time, structures called the (B) __________ form from centrioles, which will attach to the ...
Wednesday, May 21, 2014 at 9:25pm

During exercise, (B) __________ muscles in the walls of the veins contract and cause the vein walls to stiffen so more blood flows to the heart and lungs.
Wednesday, May 21, 2014 at 3:49am

Biology - Help!!
Can someone check these for me? 1. Excretion is the process of (1 point) exchanging carbon dioxide for oxygen. removing metabolic wastes from the body.*** pumping blood throughout the body to supply nutrients and oxygen to cells. breaking food down into nutrients that can be ...
Tuesday, May 20, 2014 at 11:09pm

What part absorbs light and converts it into nerve impulses What part bends light that enters the eye so that what you see is focused on your retina What part transfers the image the eye sees to the brain for perception
Tuesday, May 20, 2014 at 1:43pm

The hypothalamus secretes a hormone called GnRH that makes the anterior pituitary gland release FSH, referred to as (A)__________ hormone, and LH, or luteinizing hormone. As the levels of these two hormones increase, the oocyte and layer of cells that nourish it grow. As this ...
Tuesday, May 20, 2014 at 2:38am

biology Help
The fertilized egg undergoes cell divisions that form a ball of cells during (A)__________. During (B)__________, the endoderm, ectoderm, and mesoderm form. All the tissues of the adult body will come from these three germ layers. Differentiation is the process where cells are...
Monday, May 19, 2014 at 7:09pm

biology help
The fertilized egg undergoes cell divisions that form a ball of cells during (A)__________. During (B)__________, the endoderm, ectoderm, and mesoderm form. All the tissues of the adult body will come from these three germ layers. Differentiation is the process where cells are...
Monday, May 19, 2014 at 3:16pm

biology help
The cells in the retina that detect color and bright light are called _________ cells.
Monday, May 19, 2014 at 2:35pm

suppose some natral disaster occured and a speices of finch is forced to relocate from its original island where it dined on cactus flowers to an adjacent island with many fewer cacti but an over abundance of orchids what would be the imediate consequences to the speices in ...
Monday, May 19, 2014 at 9:52am

biology help
Frequent urination is associated with alcohol consumption because alcohol suppresses the hormone (A)__________. As a result, urine becomes more (B)__________, and the body loses more water than it should.
Monday, May 19, 2014 at 5:37am

Which type of reproduction is associated with using the most necessary resources (e.g., the most nutrients or most energy)? - binary fission - asexual reproduction - sexual reproduction - budding
Monday, May 19, 2014 at 12:52am

A strand of DNA contains the following bases. ATT CCG GGA TTT a) what amino acids are coded for? First of all, would the mRNA strand be UAA GGC CCU AAA?
Sunday, May 18, 2014 at 5:56pm

Human Biology please help
components of sense and smell Olfactory receptors in the nose travel directly to the olfactory (A)__________ before arriving at the olfactory cortex in the frontal area of the brain. This part of the brain has a direct link with the amygdala, which is involved with emotion and...
Sunday, May 18, 2014 at 3:37pm

Human Biology please help
Cross section of the brain Located in the forebrain, the (A)__________ is responsible for controlling homeostasis and making adjustments in how the organs work. While the rest of the brain is protected from viruses, bacteria, toxins, and hormones in the blood, this part of the...
Sunday, May 18, 2014 at 3:11pm

Okay my question has to do with a pedigree shown in an illustration. Since I can't show the illustration I'll do my best to describe it: There's a mother and a father and they have 4 kids: 2 boys, 2 girls. Circles represent females and squares males. A darkened ...
Friday, May 16, 2014 at 10:36pm

Proteins are manufactured through the "blueprints" found on DNA. After they are translated, they are moved through a system of internal membranes before being distributed throughout the rest of the cell. At some point in the process, they are modified to their ...
Friday, May 16, 2014 at 9:39pm

In snapdragon plants, neither one of the petal colors is dominant to the other. The hybrids have a intermediate phenotype. If a homozygous red flower is crossed with a homozygous white flower, What will the offspring’s phenotype be?_____________________________ (Use C for...
Friday, May 16, 2014 at 4:50pm

A farmer sprays insecticide on his crops and notices that the insect pest problem disappears. A year later he tries the same insecticide only to find that he did not achieve the same result. The insect population shows resistance to the insecticide. This is an example of ____ ...
Tuesday, May 13, 2014 at 11:31am

which of the following is not a part of the theory of evolution
Tuesday, May 13, 2014 at 7:37am

Can we predict or show the outcome of monohybrid crosses for parents with different allele combinations?Explain your answer
Monday, May 12, 2014 at 4:05pm

Hydrolysis uses a catabolic reaction. Explain what a catabolic reaction is and how it is useful in creating monomers from polymers.
Monday, May 12, 2014 at 2:16pm

Describe how a monomer is the basic unit of all macromolecules.
Monday, May 12, 2014 at 10:53am

Biology help please
1.Many freshwater invertebrates eliminate ammonia by: A. Converting it to uric acid and eliminating it with solid wastes. B. simple diffusion across the gill membranes. C. converting it to urea and eliminating it in their urine. D. simple diffusion across the skin.****** 2. ...
Friday, May 9, 2014 at 1:41pm

Biology help please
1.Many freshwater invertebrates eliminate ammonia by: A. Converting it to uric acid and eliminating it with solid wastes. B. simple diffusion across the gill membranes. C. converting it to urea and eliminating it in their urine. D. simple diffusion across the skin.****** 2. ...
Friday, May 9, 2014 at 7:38am

9. The restriction endonuclease AluI leaves blunt ends on DNA fragments after digestion. These blunt ends a) form hydrogen bonds with the blunt ends of other fragments produced by AluI b) are fully base paired c) have only one unpaired base d) always include the base adenine e...
Thursday, May 8, 2014 at 11:45pm

Biology PleaSE help!
Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut ...
Thursday, May 8, 2014 at 11:25pm

5. Dideoxynucleosides are employed in the course of the Sanger process of DNA sequencing. Dideocynucleosides are used because a) They stop the synthesis of DNA strands b) They are fluoresce c) They are radioactive d) They move quicly during gel electrophoresis e) They ...
Thursday, May 8, 2014 at 11:23pm

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Post a New Question | Current Questions

Homework Help: Science
