Saturday
December 10, 2016

Homework Help: Science: Biology

Recent Homework Questions About Biology

Advanced Biology
What process is being described" -the manufacture of carbohydrates, fats, and proteins -the taking in of water, food, and ions I cannot find these for the life of me. Thanks in advance.
Wednesday, December 7, 2016 by Cassandra

English
1. The greeks believed that zeus, the king of the gods, lived on mount olympus. 2. The titanic sank after hitting an iceberg off the coast of newfoundland. 3. My cousin collects scandinavian pottery. 4. Stephanie is taking english, math II, and biology. 5. On friday we were ...
Wednesday, December 7, 2016 by Hayden

biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be? A) gametes B) stem cells C) somatic cells D) epidermal cells
Tuesday, December 6, 2016 by Angelina

Biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be?
Tuesday, December 6, 2016 by Angelina

Psychology Final Exam
Check my answers? Thank you, in advance! 1. When we learn to understand the mind and feelings, we can also learn to ________ and _________ behavior. (1 point) predict and control********* understand and explain eliminate and forget explain and describe 2. Phrenology is based ...
Tuesday, December 6, 2016 by Ava

biology
1) Gene regulation in eukaryotes a) usually involves in operons b) is simpler than in prokaryotes c) allows for cell specialization d) includes the action of an operator region i think its C can you please explain to me why it is c or why it isnt if i got it wrong? thank you.
Tuesday, December 6, 2016 by carma

biology
A man is heterozygous for two genes (R and L) that are located on different chromosomes. Which of the following processes would result in different combinations of the alleles for these two genes in his sperm? a) fertilization b) independent assortment c) recombination d) ...
Friday, December 2, 2016 by katie

biology help
The features listed above describe what type of cell? Unicellular Has a cell wall May have flagella Single chromosome Ribosomes for protein synthesis
Wednesday, November 30, 2016 by angelina

Science , Biology
Which creatures live on the energy of the Sun? Angel fish Suquirrel fish Sea urchins Porcupine fish Octopus
Tuesday, November 29, 2016 by AM

Science , Biology
Is Atlantic spadefish Nocturnal or Diurnal? Carnivore, Herbivore, Autotroph? Is Porcupine fish Carnivore, Herbivore, Autotroph? Please give me informationsss!!
Tuesday, November 29, 2016 by A.

Biology
What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.
Tuesday, November 29, 2016 by babarra

Biology
Mendel described two important genetic ideas: inheritance of acquired characteristics and the principle of independent assortment. Provide a brief description of what each one means.
Tuesday, November 29, 2016 by ANG.

Science/Biology/Health and Social Care
What would happen if the body didn't have any energy? I have looked at Anabolism and Catabolism but I am overall, stuck answering this fully.
Tuesday, November 29, 2016 by Jess

biology:cells
which of the following is not true? a. ATP is formed during glycolyisis b. ATP contains less potential energy than ADP*** c. Plant cells generate ATP during cellular respiration d. ATP is used as a mobile energy carrier molecule by all cells which of the following is not true...
Monday, November 28, 2016 by Please check answers

Science , Biology
Cretaceous extinction... The evidence tells you that “overwhelming evidence suggests that the extinction was caused by a 10-km-diameter asteroid that struck Earth.” Suggest at least three lines of evidence that might have led scientists to this conclusion. Could you ...
Sunday, November 27, 2016 by Woo

Biology
What do plants and algal cells need to produce proteins? Where do plants and again cells get this supple from? THANKS!!!
Saturday, November 26, 2016 by Reece

Cell Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
In a population the proportion of homozygotes in 18 times, the proportion of homozygous recessive. Calculate the frequency of the 2 alleles?
Friday, November 25, 2016 by Kathew

math,physics,chemisty,biology
the number of moles of H2O2 required to completely react with 400ml of 0.5N KMnO4 in acidic medium are
Thursday, November 24, 2016 by Chanchal

Human and Social Biology
In guinea pigs short hair S,is dominant to long hair. A heterozygous guinea pig mated with a homozygous recessive pure breed. State the proportion of the geno type and the phenotype of the offspring
Monday, November 21, 2016 by Ancela Williams

Biology (please help!!)
Explain the process that takes place in the stroma including and reactants going in nd the products produced from these processes in a. bright sunlight and in b. darkness. c. what happens over an extended period of darkness of many days? What I need to know is part C.. I have ...
Monday, November 21, 2016 by Sara

biology
Describe how the products of fat digestion enters a person blood?
Sunday, November 20, 2016 by hamza

biology
Why do insects not die if their head is dipped in water
Friday, November 18, 2016 by dyna

Math
ella took a biology test of 54 question. She got 5/6 with a question correct how many questions did she get wrong on her biology test?
Friday, November 18, 2016 by E

Science, Biology
Can you teach me how should I answer these questions please.. Why the events are significant? First mammals: First primates: First modern humans:
Thursday, November 17, 2016 by Emma

Biology help needed bad!
A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct response to the biologist’s ...
Thursday, November 17, 2016 by Olivia N J

Biology
How male circumcion reduces the risk of HIV?
Thursday, November 17, 2016 by Ousman

Biology
How is male circumstation reduces the risk of HIV? Explain briefly
Wednesday, November 16, 2016 by Ousman

Biology
What are 2 advantages for binary fission in bacteria?
Tuesday, November 15, 2016 by Ryan

Biology
Which of the following best describes the genotypes of the offspring when Mendel crossed true-breeding (pure-breeding) yellow seed plants with true-breeding green seed plants? A) The offspring had a combination of yellow and green seeds. B) The offspring were made up of a ...
Saturday, November 12, 2016 by HELP ME!!!!!!

biology
How many possible genotypes and phenotypes are there for a single gene trait that shows dominance in any given population?
Friday, November 11, 2016 by Angelina

biology
If the first child of a couple was without dimples, an recessive trait, what is the chance that the second child will be born without dimples? A) 100% B) 25% C) 50% D) Cannot be determined from the phenotype of the child
Thursday, November 3, 2016 by K

biology
Which of the following elements is most likely to form an ion that will then form an ionic bond with an ion of a Group 1A element? Be I Fr **my choice Pt
Wednesday, November 2, 2016 by sel

Biology
Has anyone done the effect of cell size on material transport portfolio in Connections academy?
Friday, October 28, 2016 by Amanda

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...
Friday, October 28, 2016 by Maria

Biology
In which type of cell does a cell plate form during cytokinesis? a. in plant cells b. in animal cells c. in plants and animals d. in all cells answer: d
Wednesday, October 26, 2016 by Kimmy

Science, Biology
How does DNA encode the characteristics of an organism?
Tuesday, October 25, 2016 by A.

Science Biology
Can you give me a example of Natural Selection?
Tuesday, October 25, 2016 by A.

Science Biology
What does it mean to say that mutations are random?
Monday, October 24, 2016 by A.

biology (genetics)
A pure-breeding white mouse with a long tail was crossed to pure-breeding pink mouse with a short tail. The F1 progeny were all pink with long tails. These F1 mice were test crossed to white mouse with a short tail. If the gene controlling color and the gene controlling tail ...
Monday, October 24, 2016 by Jane

Biology
Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in
Friday, October 21, 2016 by Angelina

Advanced Biology
Hi could you help me with this problem as well? The alleles for red and white coat color in cattle show absence of dominance, the heterozygote being roan. A.In a freely breeding herd of 1000 head how many would you expect to be of each coat color if the allele for white coat ...
Thursday, October 20, 2016 by Cassandra

Advanced Biology
A recessive lethal gene in chickens causes circulatory failure and death of the embryo at 70 hours.A commercial hatchery finds that a hatching failure due to this gene of greater than 4% is unacceptable.What is the upper limit for the frequency of this allele in the breeding ...
Thursday, October 20, 2016 by Cassandra

Science, Biology
How did a new species with different variation affect the availability of food for the previously existing species..?
Thursday, October 20, 2016 by Oo

Science , Biology
Why does a sorting process only work when variation is present in a population?
Wednesday, October 19, 2016 by A

Biology
I need an acrostic poem with the word endomembrane.
Wednesday, October 19, 2016 by RAnia

Biology
I'm making a study guide for this class and I'm not sure about this question.. can someone give their input? There is another effect that fertilizer had on an aquatic system. What is that called? I think it may be referring to pollution?
Tuesday, October 18, 2016 by Mila

biology
someone please help me im confused and idk what im doingg how would i create a dna molecule model using straws, pushpins, and paperclips? help me, please.
Tuesday, October 18, 2016 by megann

Biology
Hi all, Need help with this: What is the difference that you see on a EKG when you have non-transmural MI vs. transmural MI? a) In transmural MI the Q wave is amplified, and the R wave is depleted making the QRS complex look inverted b) In non-transmural, the T wave is absent ...
Monday, October 17, 2016 by Bobby

maths
In a class of 60 students,the number of students who passed biology is 6 more than the number who passed chemistry.Every student passed at least one of the two subjects.i.how many students passed biology ii.how many students passed chemistry iii.how many students passed only ...
Sunday, October 16, 2016 by Obert

biology
Pearl formation is in the syllabus of aipmt or aiims?
Sunday, October 16, 2016 by Shubhangi

9th grade Biology
I really need help with the answers for the unit 2 Lesson 16: Ecology Unit Test
Saturday, October 15, 2016 by rayquaza384

Biology - Lungs
Why are there so many bronchioles in the body?
Thursday, October 13, 2016 by Louis

Biology - DNA
I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these base pairs ...
Tuesday, October 11, 2016 by Marcos

biology
Which of the following is not an organice molecule? Cellulose sucrose water testosterone
Tuesday, October 11, 2016 by kelley

biology
which of the following is not an organic compound: cellulose sucrose water testosterone
Monday, October 10, 2016 by kelley

biology
How to do a Punnett square of a F2 dihybrid cross for peas with the dominant of white flowers over pink and smooth peas over wrinkled peas?
Monday, October 10, 2016 by jodi

biology
How is a cow protein different than a human protein? How is cow DNA physically different from human DNA? Remember all proteins are made up of amino acids
Saturday, October 8, 2016 by kelley

Biology
A pore whose opening is covered by a diaphragm is clearly visible. What role do the pores serve? What would be the role of the diaphragm?
Saturday, October 8, 2016 by Anonymous

biology
amino acid is to protein as fat is to lipid DNA is to RNA sugar is to fat simple sugar is to starch
Thursday, October 6, 2016 by kelley

Biology
1. When farming, overgrazing, climate change, and/or seasonal drought change farmland into land that cannot support plant life, it is called (1 point) a. desertification. <- my answer b. depletion. c. deforestation. d. monoculture. 2. Which statement below is NOT true? (1 ...
Thursday, October 6, 2016 by Olivia N J

Biology 20
I'm using chromatography to identify compounds in a leaf extract for a lab, and one of the evaluation questions is 'Suggest a step that could be added to the procedure to isolate a specific compound for chemical testing.' What step could I use?
Wednesday, October 5, 2016 by Justin

Biology
A man made allopolyploid ceral crop is?
Wednesday, October 5, 2016 by Syed

Biology
In a population of Mendel's garden peas, the frequency of green-flowered plants (genotype aa) is 49%. The population is in Hardy-Weinberg equilibrium. What are the frequencies of the AA and Aa genotypes? I got 9% AA, 42% Aa as my answer, is this correct?
Monday, October 3, 2016 by Fay

Biology
A consumer can also be considered a a. herbivore b. autotroph c. heterotroph d. primary producer I think the answer is either a or c, because a consumer could also be a herbivore, but I don't know if the question is asking for a different name for a consumer which would be...
Monday, October 3, 2016 by Starcatcher

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...
Monday, October 3, 2016 by Dizzie

Biology
Two students were testing the amount of fertilizer that would best promote the growth of tomato plants in a garden. Which of the following could be an unavoidable source of experimental error? Select one: a. variation of tomato plants b. amount of water given to the plants c. ...
Monday, October 3, 2016 by Anonymous

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...
Sunday, October 2, 2016 by Dizzie

Biology
If a curly haired father and straight haired mother 8 children are born .the ratio of curly and straight haired will be ......
Friday, September 30, 2016 by Amie

urgent mc biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help
Wednesday, September 28, 2016 by madison

urgent mc biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2
Wednesday, September 28, 2016 by madison

multiple choice biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2 Please help
Tuesday, September 27, 2016 by madison

biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help
Tuesday, September 27, 2016 by madison

Biology
Please fill in the blanks : Proteins _____make up the _______ materials , hormones , and enzymes in living things to function correctly .
Tuesday, September 27, 2016 by Ella

Biology
6. Consider an experiment in which starch is dissolved in a liter of water. Some of the solution is placed into a securely tied dialysis bag. The dialysis bag is placed into a beaker containing distilled water and iodine for 30 minutes. What are the correct answers for the ...
Tuesday, September 27, 2016 by Lily Grace

Maths
In a class of 60students,the number of student passed Biology is 6 more than the number of student passed Chemistry,8 student passed both subject.How many student passed Biology,how many student passed Chemistry,how many student passed only one subject?
Tuesday, September 27, 2016 by Asare

biology ms sue
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought* c. after a volcanic eruption, global avarage temperatures lower d. the snow ...
Monday, September 26, 2016 by oto

biology
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought c. after a volcanic eruption, global avarage temperatures lower*** d. the snow ...
Monday, September 26, 2016 by oto

Biology
Why does humans perceive a red dress as the color red? A- The molecules of the dress do not absorb red light wavelengths B- The molecules of the dress absorb green and blue light wave lengths C- A red dress will primarily absorb red light wave length D A red dress will not ...
Monday, September 26, 2016 by dss

Biology
Light absorption by a pigment is measured for red, blue, green, and yellow light.
Sunday, September 25, 2016 by Anonymous

Biology
What is the energy of helium in its second excited state
Sunday, September 25, 2016 by Misha

biology
is c2h5 polar or non polar?
Saturday, September 24, 2016 by kailyn

Biology
Explain the structure of a water molecule and how hydrogen bonding leads to some of its very special properties. Be sure to include how these properties are important to life on Earth
Saturday, September 24, 2016 by Kayla

maths
In a class of 60 students, the number of students who passed biology is 6 more than the number who passed chemistry. Every student passed at least one of the two subjects and 8 students passed both subjects. I) how many students passed biology? ii) how many students passed ...
Wednesday, September 21, 2016 by ob

Biology
1.) All of the following statements correctly describe a polarized membrane except for: A.) a resting membrane potential of -90 mV indicates that there are more positive ions inside the axon than an RMP of -70 mV B.) A resting membrane potential of -60 mV indicates that there ...
Tuesday, September 20, 2016 by Heaven

maths
In a class of 80 students, 53 study Art, 60 study Biology, 36 study Art and Biology, 34 study Art and Chemistry, 6 study Biology only and 18 study Biology but not Chemistry. Illustrate the information on a Venn diagram. Determine the number of students who study (I) Arts only...
Tuesday, September 20, 2016 by Kwame

biology/science
Oxygen attracts electrons more strongly than hydrogen does. What kind of bond forms between the two hydrogen atoms and single oxygen atom that form a water molecule? A. A metallic bond B. A hydrogen bond C. An ionic bond D. A polar bond Currently stuck here.
Monday, September 19, 2016 by Logan

Biology
I would like some help if that is OK, like soon!:) 1.) A group of scientists proposes an idea that a chemical compound will enable bean plants to grow faster. They grow one group of bean plants in the presence of the compound and another group in the absence of the compound. ...
Monday, September 19, 2016 by Jessica

Biology
Emergency room doctors often shine a light into the eyes of patients with potential trauma to the brain to test their pupillary reflex. This is an important method in determining possible damages in the following areas of the nervous system, except: A.) optic nerve and ...
Friday, September 16, 2016 by Cherie

Biology
You begin with 10 ml of 2% acetic acid, and you add 90 ml of water. We will call the resulting solution "dilution#1". What is its concentration? You then repeat the dilution exactly, using 10ml of Dilution #1, adding 90 ml of water. We will call the resulting ...
Friday, September 16, 2016 by Ham

Biology
three similar celery stalks are placed in solution of dye for 5 mins to examine diffusion in living cells. what are some possible sources of error? suggest improvements to the experimental design?
Thursday, September 15, 2016 by Anonymous

stats
Jason, a freshman at a local college, just completed 15 credit hours. His grade report is presented below. Course: Calculus, Biology, English, Music, P.E. Credit Hours 5, 4, 3, 2, 1 Grades C, A, D, B, A The local university uses a 4 point grading system, i.e., A = 4, B = 3, C...
Thursday, September 15, 2016 by Ana

Biology
A farmer sets up a buffalo farm in this ecosystem. Over time, the buffalo greatly reduce the grass biomass in the community. Explain how the introduction of this new species could affect the amount of energy transferred within the food chain.
Wednesday, September 14, 2016 by Abigail

Biology
why is protein folding important to enzyme activity?
Wednesday, September 14, 2016 by Robert

Biology
why is protein folding important to enzyme activity?
Wednesday, September 14, 2016 by Fun

Biology
why is protein folding important to enzyme activity?
Wednesday, September 14, 2016 by Stephen Curry

biology
Both of the following processes represent what? A. A baker using yeast to make dough rise. B. Inserting human insulin genes into bacteria to make insulin for diabetics. biotechnology transgenic organisms genetic engineering all of the above
Wednesday, September 14, 2016 by katrina

Cell Biology Help Please!
1) AMP -activated protein kinase (AMPK): Option A: is activated by both AMP and ADP. Option B: undergoes allosteric regulation. Option C: all of the choices are correct. Option D: adds phosphate groups to serines and threonines in other enzymes. 2) Which of the following ...
Tuesday, September 13, 2016 by Saki

Biology
Which one of the following is NOT blood parasite? (A)plasmodium(B)trypanosoma(C)trichinell​a(D)L.donovani
Tuesday, September 13, 2016 by Bibek

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>

Homework Help: Science