Sunday
February 19, 2017

Homework Help: Science: Biology

Recent Homework Questions About Biology

biology
a. what are the composition in nutrient broth? b. give 5 different types of media used for cultivation of microbes and define each?
Sunday, February 19, 2017 by sophie

EDTECH
1. Which of the following could be an engineering project that could better protect the planet? -finding a new landfill site -designing a better trash compacter -deciding which product can be recycled*** -growing microbes that eat oil 2. Engineers who are working to find ...
Saturday, February 18, 2017 by Lily-MS.SUE ANYBODY

biology
what kind of bond holds the hydrogen to the oxygen in one water molecule??
Wednesday, February 15, 2017 by liana

Biology
how many grams of sucrose would I need to make 350mL of an 18% solution?
Monday, February 13, 2017 by Nicole

math
In a class of 80 students,53 study Art,60 study biology,36 study art and biology,34 study art and chemistry,6 study biology and 18 study biology but not chemistry.Determine the number of students who study =Art only =Chemistry only
Wednesday, February 8, 2017 by Nana Adwoa

Maths
In a class of 80 students,53 study Art,60 study biology,36 study Art and biology,34 study Art and chemistry,6 study biology but not chemistry.Illustrate the information on a Venn diagram.Determine the number of students who study Art only And Chemistry only
Wednesday, February 8, 2017 by Nana Adwoa

biology
If allele frequencies change, natural selection must be acting in some way. True or False?
Friday, February 3, 2017 by Alex

biology
A devastating tsunami wipes out most of the population of a frog species that lives on just one tropical island. What is the most likely outcome of this event? A) frequency-dependent selection B)inbreeding depression C)rapid adaptive evolution D)purging of all deleterious ...
Friday, February 3, 2017 by Alex

Biology
If I have 2.5 amylase stock solution, 2.5 PBS Buffer, and final amylase concentration of 25 [ug/ml] , how do you calculate the amylase dilution factor?
Thursday, February 2, 2017 by Sarah

Biology
Why would the GBI (Georgia Bureau of Investigation) want to use gel electrophoresis? A. Determine if someone has a genetic disease B. Determine the paternity of a child C. Determine the proper genetic sequence to make insulin D. Determine the identity of a criminal Not sure help?
Thursday, February 2, 2017 by Amber

Biology
DNA is a nucleic acid made up of monomers called A. nucleotides B. polypeptides A?
Thursday, February 2, 2017 by Amber

Biology
A heterozygous brown eyed (Bb) parent and a homozygous brown eyed parent (BB) have offspring. Which of these genotypes would not occur in their offspring? A. bb B. Bb C. BB Not positive but A?
Monday, January 30, 2017 by Amber

Biology
A genotype represented by the letters TT is considered to be which of the following? A. Heterozygous dominant B. Homozygous recessive C. Homozygous dominant D. Heterozygous recessive A? Not sure
Monday, January 30, 2017 by Amber

Biology
The short stem trait (t) is recessive to the tall stem trait (T). If a homozygous short pea plant is crossed with a heterozygous tall plant, what is the chance that the offspring will be short? A. one out of four B. three out of four C. all four D. two out of four ???
Monday, January 30, 2017 by Amber

Biology
John has blue eyes. Blue eyes are recessive to the dominant trait for brown eye color. His genotype is bb. What is Johns phenotype? I don't know. Explain?
Monday, January 30, 2017 by Amber

Biology
Mendel crossed two pea plants. One pea plant was homozygous tall (TT) and the other was homozygous short (tt). What are the possible phenotypes (how many tall plants and how many short plants did he get?) I don't understand questions like this.
Monday, January 30, 2017 by Amber

Biology
A homozygous short dog (dd) is crossed with a heterozygous tall dog (Dd). What is the probability that the offspring will be short? Not sure ?
Monday, January 30, 2017 by Amber

biology
what role doescarbon dioxide play in plant processes
Sunday, January 29, 2017 by Anonymous

Biology
During the Late Carboniferous, Indiana lay close to the equator, making the climate humid and warm. Swamps and wetlands were prominent in much of the state. Dominant fossil plants from this time include lycopods, conifers, and seed ferns (extinct gymnosperms). Plant material ...
Saturday, January 28, 2017 by Angelina

Biology
John has blue eyes, blue eyes are recessive to the dominant trait for brown eye color. his genotype is bb . What is johns phenotype? A. brown B. Bb C. Blue D. bb My best answer is B
Friday, January 27, 2017 by Leslie

biology
John has blue eyes, blue eyes are recessive to the dominant trait for brown eye color. his genotype is bb . What is johns phenotype? A. brown B. Bb C. Blue D. bb My best answer is B
Friday, January 27, 2017 by Leslie

biology
1)Can you suggest reasons why a phylogeny based on molecular evidence and a phylogeny based on morphology and other evidence might not be exactly the same? 2) Zoologist worldwide are sequencing a mitochondrial gene CO1 (cyctochrome c oxidase subunit), which is found in all ...
Friday, January 27, 2017 by Henry

biology
Which of the following organs remove nitrogenous waste from the body? a. Liver b. Large Intestine c. Kidneys d. Gall Bladder
Thursday, January 26, 2017 by Jane

Biology
27. Part A. Make a punnett square (as best as you can in this online format) and cross parents both with the thumb genes Aa (A=normal thumb, a=hitchhikers thumb) and show the results. (1 pt) A a A AA Aa a Aa aa 27 Part B. (1 pt) Approximately what percentage of their children ...
Thursday, January 26, 2017 by Zoi

BIOLOGY/EVOLUTION
Q7. In the Mountains and Valleys exercise, which of the following parameters had the largest influence on whether the finch population evolved a bimodal distribution? The speed at which the model ran. The difference in carrying capacity between the wet versus dry sides of the ...
Thursday, January 26, 2017 by anonymous

DAV; subject biology
What are bio - degradable pollutant?
Tuesday, January 24, 2017 by harish

biology
Scientific Method Project In a 2-page maximum type written paper, complete research on a topic of question from the readings. Utilizing the scientific method, document the application of the steps in determining your hypothesis and findings. Each step is worth up to 20 points...
Monday, January 23, 2017 by carol

biology
Which is an ion found in a glass of water? i think it would be oxygen, correct?
Thursday, January 19, 2017 by Castermans.m

Biology
An example of homologous structures would be our front teeth and ___: a. the mandibles of a crab b. the mouthparts of a mosquito c. the beak of a bird d. the tentacles of a sea worm e. the front teeth of a horse I'm having difficult on which answer is right (my answer would be...
Wednesday, January 18, 2017 by KC

Biology
A green flower (GG) is crossed with a white flower (gg). Which combination of alleles is a possible outcome? * a. GG only b. gg only c. Gg only Not sure to be honest? Help?
Wednesday, January 18, 2017 by Amber

Biology
Explain the meanings of Mendel’s principle of segregation and principle of independent assortment. Under what circumstances does the principle of independent assortment hold true? Give an example in which this law does not apply.
Tuesday, January 17, 2017 by Sarah

Biology
I have a question on plant science, wondering where I can get the answer..
Tuesday, January 17, 2017 by Jeff

Biology
2 g of glycine (C2H5NO2) are dissolved in water to a total volume of 3 L. What is the concentration of the glycine solution in M? Round answers to two significant figures.
Monday, January 16, 2017 by Tori

Biology
what is the definition of respiration?
Monday, January 16, 2017 by lopiah

Biology
What is DNA replication?
Wednesday, January 11, 2017 by Annabeth

biology
Can you please explain this to me? List all the possible genotypes of a pea plant with purple flowers and round seeds.
Tuesday, January 10, 2017 by Kelley

biology
Sketch a mold cell and label the key parts. Include all of the following:  Ribosomes  Mitochondrion  Endoplasmic reticulum  Nucleus  Cell wall  Cell membrane  Golgi apparatus  Vacuole  Centriole
Monday, January 9, 2017 by Diamondchic

biology
Convert these dates to BP dates (using 1950 as "the present.") Wood fragments from the floor of a palace in Syria - Syro-Hittite period. Date: 675 ± 50 years BCE
Thursday, January 5, 2017 by bailey

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be around ...
Tuesday, January 3, 2017 by Anonymous

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be around ...
Tuesday, January 3, 2017 by andrea

Biology science
What is the nature of the phloem vessels after they are stained in the microscopic sections
Tuesday, December 27, 2016 by Ibrahim

Biology
State the changes that occur in arterioles in the human skin during thermoregulation
Tuesday, December 27, 2016 by Edith

Biology
What's the importance of destination in a mammal
Tuesday, December 27, 2016 by Edith

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?
Monday, December 26, 2016 by lama

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?
Sunday, December 25, 2016 by lama

Biology
State the cell theory as we understand it today.
Sunday, December 25, 2016 by Khaled

Biology
What is the purpose of control in a scientific experiment.
Sunday, December 25, 2016 by Khaled

Biology
1. Why water potential values are negative? 2. Why turgidity is so important for plant cell?
Sunday, December 25, 2016 by Yesuf

Biology
What are electronic wastes?
Tuesday, December 20, 2016 by Abhishek

Biology
The anticodon for GCG is: A) AUA B) CCT C) UAU D) CGC **D
Monday, December 19, 2016 by Stacy

biology
In Angus cattle, the fur color black (B) is dominant to the color red (b). If we cross a homozygous dominant bull with a homozygous recessive cow is it possible for the offspring to be red?
Friday, December 16, 2016 by patrina

Biology
1. True or false: even when your research does not support your hypothesis, the hypothesis has value. True False 2. Which one of these could define a "hypothesis?" educated guess conclusion scientific prediction 3. Once you have formulated your hypothesis, you would ...
Wednesday, December 14, 2016 by Leslie

Biology
what does ribosome mean in simple english?
Wednesday, December 14, 2016 by student

Biology
Refer to the illustration above.wich point on the graph indicates approximate world population in the year 1950
Wednesday, December 14, 2016 by Galilea

physics biology chemistry and ict
WHAT ARE THE ALLOTROPES OF ANTIMONY
Tuesday, December 13, 2016 by SEINI OUSMAN

Advanced Biology
What process is being described" -the manufacture of carbohydrates, fats, and proteins -the taking in of water, food, and ions I cannot find these for the life of me. Thanks in advance.
Wednesday, December 7, 2016 by Cassandra

English
1. The greeks believed that zeus, the king of the gods, lived on mount olympus. 2. The titanic sank after hitting an iceberg off the coast of newfoundland. 3. My cousin collects scandinavian pottery. 4. Stephanie is taking english, math II, and biology. 5. On friday we were ...
Wednesday, December 7, 2016 by Hayden

biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be? A) gametes B) stem cells C) somatic cells D) epidermal cells
Tuesday, December 6, 2016 by Angelina

Biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be?
Tuesday, December 6, 2016 by Angelina

Psychology Final Exam
Check my answers? Thank you, in advance! 1. When we learn to understand the mind and feelings, we can also learn to ________ and _________ behavior. (1 point) predict and control********* understand and explain eliminate and forget explain and describe 2. Phrenology is based ...
Tuesday, December 6, 2016 by Ava

biology
1) Gene regulation in eukaryotes a) usually involves in operons b) is simpler than in prokaryotes c) allows for cell specialization d) includes the action of an operator region i think its C can you please explain to me why it is c or why it isnt if i got it wrong? thank you.
Tuesday, December 6, 2016 by carma

biology
A man is heterozygous for two genes (R and L) that are located on different chromosomes. Which of the following processes would result in different combinations of the alleles for these two genes in his sperm? a) fertilization b) independent assortment c) recombination d) ...
Friday, December 2, 2016 by katie

biology help
The features listed above describe what type of cell? Unicellular Has a cell wall May have flagella Single chromosome Ribosomes for protein synthesis
Wednesday, November 30, 2016 by angelina

Science , Biology
Which creatures live on the energy of the Sun? Angel fish Suquirrel fish Sea urchins Porcupine fish Octopus
Tuesday, November 29, 2016 by AM

Science , Biology
Is Atlantic spadefish Nocturnal or Diurnal? Carnivore, Herbivore, Autotroph? Is Porcupine fish Carnivore, Herbivore, Autotroph? Please give me informationsss!!
Tuesday, November 29, 2016 by A.

Biology
What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.
Tuesday, November 29, 2016 by babarra

Biology
Mendel described two important genetic ideas: inheritance of acquired characteristics and the principle of independent assortment. Provide a brief description of what each one means.
Tuesday, November 29, 2016 by ANG.

Science/Biology/Health and Social Care
What would happen if the body didn't have any energy? I have looked at Anabolism and Catabolism but I am overall, stuck answering this fully.
Tuesday, November 29, 2016 by Jess

biology:cells
which of the following is not true? a. ATP is formed during glycolyisis b. ATP contains less potential energy than ADP*** c. Plant cells generate ATP during cellular respiration d. ATP is used as a mobile energy carrier molecule by all cells which of the following is not true...
Monday, November 28, 2016 by Please check answers

Science , Biology
Cretaceous extinction... The evidence tells you that “overwhelming evidence suggests that the extinction was caused by a 10-km-diameter asteroid that struck Earth.” Suggest at least three lines of evidence that might have led scientists to this conclusion. Could you please...
Sunday, November 27, 2016 by Woo

Biology
What do plants and algal cells need to produce proteins? Where do plants and again cells get this supple from? THANKS!!!
Saturday, November 26, 2016 by Reece

Cell Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
In a population the proportion of homozygotes in 18 times, the proportion of homozygous recessive. Calculate the frequency of the 2 alleles?
Friday, November 25, 2016 by Kathew

math,physics,chemisty,biology
the number of moles of H2O2 required to completely react with 400ml of 0.5N KMnO4 in acidic medium are
Thursday, November 24, 2016 by Chanchal

Human and Social Biology
In guinea pigs short hair S,is dominant to long hair. A heterozygous guinea pig mated with a homozygous recessive pure breed. State the proportion of the geno type and the phenotype of the offspring
Monday, November 21, 2016 by Ancela Williams

Biology (please help!!)
Explain the process that takes place in the stroma including and reactants going in nd the products produced from these processes in a. bright sunlight and in b. darkness. c. what happens over an extended period of darkness of many days? What I need to know is part C.. I have ...
Monday, November 21, 2016 by Sara

biology
Describe how the products of fat digestion enters a person blood?
Sunday, November 20, 2016 by hamza

biology
Why do insects not die if their head is dipped in water
Friday, November 18, 2016 by dyna

Math
ella took a biology test of 54 question. She got 5/6 with a question correct how many questions did she get wrong on her biology test?
Friday, November 18, 2016 by E

Science, Biology
Can you teach me how should I answer these questions please.. Why the events are significant? First mammals: First primates: First modern humans:
Thursday, November 17, 2016 by Emma

Biology help needed bad!
A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct response to the biologist’s discovery...
Thursday, November 17, 2016 by Olivia N J

Biology
How male circumcion reduces the risk of HIV?
Thursday, November 17, 2016 by Ousman

Biology
How is male circumstation reduces the risk of HIV? Explain briefly
Wednesday, November 16, 2016 by Ousman

Biology
What are 2 advantages for binary fission in bacteria?
Tuesday, November 15, 2016 by Ryan

Biology
Which of the following best describes the genotypes of the offspring when Mendel crossed true-breeding (pure-breeding) yellow seed plants with true-breeding green seed plants? A) The offspring had a combination of yellow and green seeds. B) The offspring were made up of a ...
Saturday, November 12, 2016 by HELP ME!!!!!!

biology
How many possible genotypes and phenotypes are there for a single gene trait that shows dominance in any given population?
Friday, November 11, 2016 by Angelina

biology
If the first child of a couple was without dimples, an recessive trait, what is the chance that the second child will be born without dimples? A) 100% B) 25% C) 50% D) Cannot be determined from the phenotype of the child
Thursday, November 3, 2016 by K

biology
Which of the following elements is most likely to form an ion that will then form an ionic bond with an ion of a Group 1A element? Be I Fr **my choice Pt
Wednesday, November 2, 2016 by sel

Biology
Has anyone done the effect of cell size on material transport portfolio in Connections academy?
Friday, October 28, 2016 by Amanda

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...
Friday, October 28, 2016 by Maria

Biology
In which type of cell does a cell plate form during cytokinesis? a. in plant cells b. in animal cells c. in plants and animals d. in all cells answer: d
Wednesday, October 26, 2016 by Kimmy

Science, Biology
How does DNA encode the characteristics of an organism?
Tuesday, October 25, 2016 by A.

Science Biology
Can you give me a example of Natural Selection?
Tuesday, October 25, 2016 by A.

Science Biology
What does it mean to say that mutations are random?
Monday, October 24, 2016 by A.

biology (genetics)
A pure-breeding white mouse with a long tail was crossed to pure-breeding pink mouse with a short tail. The F1 progeny were all pink with long tails. These F1 mice were test crossed to white mouse with a short tail. If the gene controlling color and the gene controlling tail ...
Monday, October 24, 2016 by Jane

Biology
Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in
Friday, October 21, 2016 by Angelina

Advanced Biology
Hi could you help me with this problem as well? The alleles for red and white coat color in cattle show absence of dominance, the heterozygote being roan. A.In a freely breeding herd of 1000 head how many would you expect to be of each coat color if the allele for white coat ...
Thursday, October 20, 2016 by Cassandra

Advanced Biology
A recessive lethal gene in chickens causes circulatory failure and death of the embryo at 70 hours.A commercial hatchery finds that a hatching failure due to this gene of greater than 4% is unacceptable.What is the upper limit for the frequency of this allele in the breeding ...
Thursday, October 20, 2016 by Cassandra

Science, Biology
How did a new species with different variation affect the availability of food for the previously existing species..?
Thursday, October 20, 2016 by Oo

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>

Homework Help: Science