Tuesday
January 17, 2017

Homework Help: Science: Biology

Recent Homework Questions About Biology

Biology
Explain the meanings of Mendel’s principle of segregation and principle of independent assortment. Under what circumstances does the principle of independent assortment hold true? Give an example in which this law does not apply.
Tuesday, January 17, 2017 by Sarah

Biology
I have a question on plant science, wondering where I can get the answer..
Tuesday, January 17, 2017 by Jeff

Biology
2 g of glycine (C2H5NO2) are dissolved in water to a total volume of 3 L. What is the concentration of the glycine solution in M? Round answers to two significant figures.
Monday, January 16, 2017 by Tori

Biology
what is the definition of respiration?
Monday, January 16, 2017 by lopiah

Biology
What is DNA replication?
Wednesday, January 11, 2017 by Annabeth

biology
Can you please explain this to me? List all the possible genotypes of a pea plant with purple flowers and round seeds.
Tuesday, January 10, 2017 by Kelley

biology
Sketch a mold cell and label the key parts. Include all of the following: ï‚· Ribosomes ï‚· Mitochondrion ï‚· Endoplasmic reticulum ï‚· Nucleus ï‚· Cell wall ï‚· Cell membrane...
Monday, January 9, 2017 by Diamondchic

biology
Convert these dates to BP dates (using 1950 as "the present.") Wood fragments from the floor of a palace in Syria - Syro-Hittite period. Date: 675 ± 50 years BCE
Thursday, January 5, 2017 by bailey

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be ...
Tuesday, January 3, 2017 by Anonymous

biology
1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken DNA should be ...
Tuesday, January 3, 2017 by andrea

Biology science
What is the nature of the phloem vessels after they are stained in the microscopic sections
Tuesday, December 27, 2016 by Ibrahim

Biology
State the changes that occur in arterioles in the human skin during thermoregulation
Tuesday, December 27, 2016 by Edith

Biology
What's the importance of destination in a mammal
Tuesday, December 27, 2016 by Edith

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?
Monday, December 26, 2016 by lama

biology
How can the absence of starch in the elaborated sap be explained knowing that it is produced by photosynthesis ?
Sunday, December 25, 2016 by lama

Biology
State the cell theory as we understand it today.
Sunday, December 25, 2016 by Khaled

Biology
What is the purpose of control in a scientific experiment.
Sunday, December 25, 2016 by Khaled

Biology
1. Why water potential values are negative? 2. Why turgidity is so important for plant cell?
Sunday, December 25, 2016 by Yesuf

Biology
What are electronic wastes?
Tuesday, December 20, 2016 by Abhishek

Biology
The anticodon for GCG is: A) AUA B) CCT C) UAU D) CGC **D
Monday, December 19, 2016 by Stacy

biology
In Angus cattle, the fur color black (B) is dominant to the color red (b). If we cross a homozygous dominant bull with a homozygous recessive cow is it possible for the offspring to be red?
Friday, December 16, 2016 by patrina

Biology
1. True or false: even when your research does not support your hypothesis, the hypothesis has value. True False 2. Which one of these could define a "hypothesis?" educated guess conclusion scientific prediction 3. Once you have formulated your hypothesis, you would ...
Wednesday, December 14, 2016 by Leslie

Biology
what does ribosome mean in simple english?
Wednesday, December 14, 2016 by student

Biology
Refer to the illustration above.wich point on the graph indicates approximate world population in the year 1950
Wednesday, December 14, 2016 by Galilea

physics biology chemistry and ict
WHAT ARE THE ALLOTROPES OF ANTIMONY
Tuesday, December 13, 2016 by SEINI OUSMAN

Advanced Biology
What process is being described" -the manufacture of carbohydrates, fats, and proteins -the taking in of water, food, and ions I cannot find these for the life of me. Thanks in advance.
Wednesday, December 7, 2016 by Cassandra

English
1. The greeks believed that zeus, the king of the gods, lived on mount olympus. 2. The titanic sank after hitting an iceberg off the coast of newfoundland. 3. My cousin collects scandinavian pottery. 4. Stephanie is taking english, math II, and biology. 5. On friday we were ...
Wednesday, December 7, 2016 by Hayden

biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be? A) gametes B) stem cells C) somatic cells D) epidermal cells
Tuesday, December 6, 2016 by Angelina

Biology
All of the cells are in the very early stages of embryonic development and have not begun to differentiate into specialized types of cells. What type of cells would these be?
Tuesday, December 6, 2016 by Angelina

Psychology Final Exam
Check my answers? Thank you, in advance! 1. When we learn to understand the mind and feelings, we can also learn to ________ and _________ behavior. (1 point) predict and control********* understand and explain eliminate and forget explain and describe 2. Phrenology is based ...
Tuesday, December 6, 2016 by Ava

biology
1) Gene regulation in eukaryotes a) usually involves in operons b) is simpler than in prokaryotes c) allows for cell specialization d) includes the action of an operator region i think its C can you please explain to me why it is c or why it isnt if i got it wrong? thank you.
Tuesday, December 6, 2016 by carma

biology
A man is heterozygous for two genes (R and L) that are located on different chromosomes. Which of the following processes would result in different combinations of the alleles for these two genes in his sperm? a) fertilization b) independent assortment c) recombination d) ...
Friday, December 2, 2016 by katie

biology help
The features listed above describe what type of cell? Unicellular Has a cell wall May have flagella Single chromosome Ribosomes for protein synthesis
Wednesday, November 30, 2016 by angelina

Science , Biology
Which creatures live on the energy of the Sun? Angel fish Suquirrel fish Sea urchins Porcupine fish Octopus
Tuesday, November 29, 2016 by AM

Science , Biology
Is Atlantic spadefish Nocturnal or Diurnal? Carnivore, Herbivore, Autotroph? Is Porcupine fish Carnivore, Herbivore, Autotroph? Please give me informationsss!!
Tuesday, November 29, 2016 by A.

Biology
What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.
Tuesday, November 29, 2016 by babarra

Biology
Mendel described two important genetic ideas: inheritance of acquired characteristics and the principle of independent assortment. Provide a brief description of what each one means.
Tuesday, November 29, 2016 by ANG.

Science/Biology/Health and Social Care
What would happen if the body didn't have any energy? I have looked at Anabolism and Catabolism but I am overall, stuck answering this fully.
Tuesday, November 29, 2016 by Jess

biology:cells
which of the following is not true? a. ATP is formed during glycolyisis b. ATP contains less potential energy than ADP*** c. Plant cells generate ATP during cellular respiration d. ATP is used as a mobile energy carrier molecule by all cells which of the following is not true...
Monday, November 28, 2016 by Please check answers

Science , Biology
Cretaceous extinction... The evidence tells you that “overwhelming evidence suggests that the extinction was caused by a 10-km-diameter asteroid that struck Earth.” Suggest at least three lines of evidence that might have led scientists to ...
Sunday, November 27, 2016 by Woo

Biology
What do plants and algal cells need to produce proteins? Where do plants and again cells get this supple from? THANKS!!!
Saturday, November 26, 2016 by Reece

Cell Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
The concept of receptor affinity does not only apply to the original receptor and ligand. For which of the following pairs of interacting molecules in signal transduction would a change in affinity of one for the other NOT affect how they work in signal transduction? A) ...
Friday, November 25, 2016 by Kelsey

Biology
In a population the proportion of homozygotes in 18 times, the proportion of homozygous recessive. Calculate the frequency of the 2 alleles?
Friday, November 25, 2016 by Kathew

math,physics,chemisty,biology
the number of moles of H2O2 required to completely react with 400ml of 0.5N KMnO4 in acidic medium are
Thursday, November 24, 2016 by Chanchal

Human and Social Biology
In guinea pigs short hair S,is dominant to long hair. A heterozygous guinea pig mated with a homozygous recessive pure breed. State the proportion of the geno type and the phenotype of the offspring
Monday, November 21, 2016 by Ancela Williams

Biology (please help!!)
Explain the process that takes place in the stroma including and reactants going in nd the products produced from these processes in a. bright sunlight and in b. darkness. c. what happens over an extended period of darkness of many days? What I need to know is part C.. I have ...
Monday, November 21, 2016 by Sara

biology
Describe how the products of fat digestion enters a person blood?
Sunday, November 20, 2016 by hamza

biology
Why do insects not die if their head is dipped in water
Friday, November 18, 2016 by dyna

Math
ella took a biology test of 54 question. She got 5/6 with a question correct how many questions did she get wrong on her biology test?
Friday, November 18, 2016 by E

Science, Biology
Can you teach me how should I answer these questions please.. Why the events are significant? First mammals: First primates: First modern humans:
Thursday, November 17, 2016 by Emma

Biology help needed bad!
A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct response to the biologistâ€...
Thursday, November 17, 2016 by Olivia N J

Biology
How male circumcion reduces the risk of HIV?
Thursday, November 17, 2016 by Ousman

Biology
How is male circumstation reduces the risk of HIV? Explain briefly
Wednesday, November 16, 2016 by Ousman

Biology
What are 2 advantages for binary fission in bacteria?
Tuesday, November 15, 2016 by Ryan

Biology
Which of the following best describes the genotypes of the offspring when Mendel crossed true-breeding (pure-breeding) yellow seed plants with true-breeding green seed plants? A) The offspring had a combination of yellow and green seeds. B) The offspring were made up of a ...
Saturday, November 12, 2016 by HELP ME!!!!!!

biology
How many possible genotypes and phenotypes are there for a single gene trait that shows dominance in any given population?
Friday, November 11, 2016 by Angelina

biology
If the first child of a couple was without dimples, an recessive trait, what is the chance that the second child will be born without dimples? A) 100% B) 25% C) 50% D) Cannot be determined from the phenotype of the child
Thursday, November 3, 2016 by K

biology
Which of the following elements is most likely to form an ion that will then form an ionic bond with an ion of a Group 1A element? Be I Fr **my choice Pt
Wednesday, November 2, 2016 by sel

Biology
Has anyone done the effect of cell size on material transport portfolio in Connections academy?
Friday, October 28, 2016 by Amanda

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...
Friday, October 28, 2016 by Maria

Biology
In which type of cell does a cell plate form during cytokinesis? a. in plant cells b. in animal cells c. in plants and animals d. in all cells answer: d
Wednesday, October 26, 2016 by Kimmy

Science, Biology
How does DNA encode the characteristics of an organism?
Tuesday, October 25, 2016 by A.

Science Biology
Can you give me a example of Natural Selection?
Tuesday, October 25, 2016 by A.

Science Biology
What does it mean to say that mutations are random?
Monday, October 24, 2016 by A.

biology (genetics)
A pure-breeding white mouse with a long tail was crossed to pure-breeding pink mouse with a short tail. The F1 progeny were all pink with long tails. These F1 mice were test crossed to white mouse with a short tail. If the gene controlling color and the gene controlling tail ...
Monday, October 24, 2016 by Jane

Biology
Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in
Friday, October 21, 2016 by Angelina

Advanced Biology
Hi could you help me with this problem as well? The alleles for red and white coat color in cattle show absence of dominance, the heterozygote being roan. A.In a freely breeding herd of 1000 head how many would you expect to be of each coat color if the allele for white coat ...
Thursday, October 20, 2016 by Cassandra

Advanced Biology
A recessive lethal gene in chickens causes circulatory failure and death of the embryo at 70 hours.A commercial hatchery finds that a hatching failure due to this gene of greater than 4% is unacceptable.What is the upper limit for the frequency of this allele in the breeding ...
Thursday, October 20, 2016 by Cassandra

Science, Biology
How did a new species with different variation affect the availability of food for the previously existing species..?
Thursday, October 20, 2016 by Oo

Science , Biology
Why does a sorting process only work when variation is present in a population?
Wednesday, October 19, 2016 by A

Biology
I need an acrostic poem with the word endomembrane.
Wednesday, October 19, 2016 by RAnia

Biology
I'm making a study guide for this class and I'm not sure about this question.. can someone give their input? There is another effect that fertilizer had on an aquatic system. What is that called? I think it may be referring to pollution?
Tuesday, October 18, 2016 by Mila

biology
someone please help me im confused and idk what im doingg how would i create a dna molecule model using straws, pushpins, and paperclips? help me, please.
Tuesday, October 18, 2016 by megann

Biology
Hi all, Need help with this: What is the difference that you see on a EKG when you have non-transmural MI vs. transmural MI? a) In transmural MI the Q wave is amplified, and the R wave is depleted making the QRS complex look inverted b) In non-transmural, the T wave is absent ...
Monday, October 17, 2016 by Bobby

maths
In a class of 60 students,the number of students who passed biology is 6 more than the number who passed chemistry.Every student passed at least one of the two subjects.i.how many students passed biology ii.how many students passed chemistry iii.how many students passed only ...
Sunday, October 16, 2016 by Obert

biology
Pearl formation is in the syllabus of aipmt or aiims?
Sunday, October 16, 2016 by Shubhangi

9th grade Biology
I really need help with the answers for the unit 2 Lesson 16: Ecology Unit Test
Saturday, October 15, 2016 by rayquaza384

Biology - Lungs
Why are there so many bronchioles in the body?
Thursday, October 13, 2016 by Louis

Biology - DNA
I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these base pairs ...
Tuesday, October 11, 2016 by Marcos

biology
Which of the following is not an organice molecule? Cellulose sucrose water testosterone
Tuesday, October 11, 2016 by kelley

biology
which of the following is not an organic compound: cellulose sucrose water testosterone
Monday, October 10, 2016 by kelley

biology
How to do a Punnett square of a F2 dihybrid cross for peas with the dominant of white flowers over pink and smooth peas over wrinkled peas?
Monday, October 10, 2016 by jodi

biology
How is a cow protein different than a human protein? How is cow DNA physically different from human DNA? Remember all proteins are made up of amino acids
Saturday, October 8, 2016 by kelley

Biology
A pore whose opening is covered by a diaphragm is clearly visible. What role do the pores serve? What would be the role of the diaphragm?
Saturday, October 8, 2016 by Anonymous

biology
amino acid is to protein as fat is to lipid DNA is to RNA sugar is to fat simple sugar is to starch
Thursday, October 6, 2016 by kelley

Biology
1. When farming, overgrazing, climate change, and/or seasonal drought change farmland into land that cannot support plant life, it is called (1 point) a. desertification. <- my answer b. depletion. c. deforestation. d. monoculture. 2. Which statement below is NOT true? (1 ...
Thursday, October 6, 2016 by Olivia N J

Biology 20
I'm using chromatography to identify compounds in a leaf extract for a lab, and one of the evaluation questions is 'Suggest a step that could be added to the procedure to isolate a specific compound for chemical testing.' What step could I use?
Wednesday, October 5, 2016 by Justin

Biology
A man made allopolyploid ceral crop is?
Wednesday, October 5, 2016 by Syed

Biology
In a population of Mendel's garden peas, the frequency of green-flowered plants (genotype aa) is 49%. The population is in Hardy-Weinberg equilibrium. What are the frequencies of the AA and Aa genotypes? I got 9% AA, 42% Aa as my answer, is this correct?
Monday, October 3, 2016 by Fay

Biology
A consumer can also be considered a a. herbivore b. autotroph c. heterotroph d. primary producer I think the answer is either a or c, because a consumer could also be a herbivore, but I don't know if the question is asking for a different name for a consumer which would be...
Monday, October 3, 2016 by Starcatcher

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...
Monday, October 3, 2016 by Dizzie

Biology
Two students were testing the amount of fertilizer that would best promote the growth of tomato plants in a garden. Which of the following could be an unavoidable source of experimental error? Select one: a. variation of tomato plants b. amount of water given to the plants c. ...
Monday, October 3, 2016 by Anonymous

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...
Sunday, October 2, 2016 by Dizzie

Biology
If a curly haired father and straight haired mother 8 children are born .the ratio of curly and straight haired will be ......
Friday, September 30, 2016 by Amie

urgent mc biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help
Wednesday, September 28, 2016 by madison

urgent mc biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2
Wednesday, September 28, 2016 by madison

multiple choice biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2 Please help
Tuesday, September 27, 2016 by madison

biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help
Tuesday, September 27, 2016 by madison

Biology
Please fill in the blanks : Proteins _____make up the _______ materials , hormones , and enzymes in living things to function correctly .
Tuesday, September 27, 2016 by Ella

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>

Homework Help: Science