August 29, 2015

Posts by tony

Total # Posts: 872

A taxi driver charges a flat rate of $3.00 and $0.08 per mile traveled
February 11, 2012

math at
Mary has read 1/3 of a 240-page book. How many pages does she still have to read to finish the book? What percent of the book does she still have to read?
February 9, 2012

Throw out the high and low values and average the remaining factors
February 8, 2012

Medical Terminology
Why is it so important to know terms that are associated with all of thedifferent body systems even if you were to only work with onesystem?
February 6, 2012

need root or base word
February 5, 2012

February 5, 2012

when would you not use it
February 5, 2012

it doesn't have the root word
February 5, 2012

answer each question based on your understanding of the boldfaced vocabulary what are some situation when levity is out of place
February 5, 2012

whats the root or base word of rebellious,belligerent, doctrine, document, levity, levitate, initiative, itinerary, impulsive, compel
February 5, 2012

time take=80.67min distance=91.42km
January 22, 2012

Please help me with question #2: How do you determine if there is a linear relationship between NaCO3 used and CO2 produced?Discuss your results in terms of moles. Thank you!! Question #1 : 1. Record the amount of CO2 produced versus the amount of Na2CO3 used. Answer : 1.The ...
January 20, 2012

I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

4thGrade Math
8.8 inches
January 19, 2012

Please help me with the questions at the end of this chemistry lab.Thank you for any help you can provide. 1. This experiment requires you to do 7 trials with varying amounts of Na©üCO©ý. 2. Take a clean 50 mL beaker from the Glassware shelf and place it ...
January 19, 2012

find the coordinates of the circumcenter of tringleABC A(3,-1),B(-2,-1),C(3,-8)
January 13, 2012

You are driving your car and the traffic light ahead turns red. you apply the breaks for 3.0 s, and the velocity of the care decrease for +4.5 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 11, 2012

You are driving you car and the traffic light ahead turns red. you apply the breaks for 3.0s, and the velocity of the care decrease for +45 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 10, 2012

What is the magnitude of the average acceleration of a skier who, starting from rest, reachers a speed of 8.0m/s when going down a slope for 5.0 s? how far does the skier travel in this time?
January 10, 2012

December 15, 2011

Ken paid $8.50 for tickets an adult paid $2.00 more than a child how much does the adult pay
December 1, 2011

November 30, 2011

November 29, 2011

I dont know how to simplify
November 29, 2011

A box contains 1 white bow, 2 yellow bows, 3 red bows, and 6 green bows. The bows are all the same size and shape. If Patricia reaches in the box and pulls out a bow without looking, what is the probability that it will be yellow? A.1/12 B.2/10 C.1/6 D.1/4
November 29, 2011

Thanks that is what i did but i wasn't sure if i had to include the extra 1/2 sheet in my answer.
November 22, 2011

thank you. would you know how to draw that out in pictures. I have to use a picture. thank you
November 22, 2011

in art class there are 5 sheets of drawing paper for 9 people. how much paper will each person get?
November 22, 2011

Joyce took out a loan for $21,900 at 12 percent on March 18, 2007, which will be due on January 9, 2008. Using ordinary interest, Joyce will pay back on Jan. 9 a total amount:
November 20, 2011

business math
Matty Kaminsky owns a new Volvo. His June monthly interest was $400. The rate is 8 ½ percent. Matty's principal balance at the beginning of June is: (Use 360 days)
November 20, 2011

A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in the general population. A random sample of 90 students at a private high school is tested and and a mean SAT score of 1030 is obtained. The average ...
November 19, 2011

A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in the general population. A random sample of 90 students at a private high school is tested and has a mean SAT score of 1050. The average score for ...
November 19, 2011

Use elements in the order given to determine rows and columns of the matrix. R on {1,2,3,4} where aRb means |a-b| <1. R on {1,2,3,4,6,12} where aRb means a|b.
November 18, 2011

50 is what percent of 900 (Round to nearest tenth of a percent
November 11, 2011

The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011

prepare the appropriate adjusting entry for the year Rent of $24,000 for a full year was paid on August 31,2011
October 30, 2011

(0,2) is correct it is (2,12) not (2,8)
October 28, 2011

A woman drops a basketball, how far does it fall in one second? use formulas
October 28, 2011

college math
1 __ 5 and 1 __ 20
October 26, 2011

college math
Aging in the United States In 2050, about 1 over 5 of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in 2050. (Source: U.S. Census Bureau.)
October 26, 2011

i posted this yesterday and never recieved a answer i do really neeed this help need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. ...
October 26, 2011

need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in ...
October 25, 2011

need step by step on how we get the answer Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal.(Source: U.S. Census Bureau.)
October 25, 2011

question is need for you to show me how you got the answer step by step in order to learn on how to do the other ones.
October 25, 2011

need help in solving Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal. (Source: U.S. Census Bureau.)
October 25, 2011

calculate the density of oxygen,O/2 under each of the followig conditions-stp,1.00 atm and 35.0 celsius?
October 19, 2011

why is the energy difference for t-butylcyclohexane significantly greater than the corresponding value calculated for methylcyclohexane?
October 13, 2011

what is a conjunction give example
October 12, 2011

When finding how high the platform is the horizontal velocity isn't important. S= 1/2at^2 where S is the displacement and a is the acceleration due to gravity (9.8) so S=(1/2) (9.8) 1.7^2 S=4.9*1.7^2 S=14.161 meters When finding how far from the base Janet lands use the ...
October 12, 2011

assume that $10 million dollars of debt replaces 625,000 shares of common stock. The intrest in the new stock is 11.25 percent what will projected earnings per share be based on the anticipated sales increase of $500,000
October 11, 2011

I just looked it up in my book pg 546 the answer is B
October 10, 2011

Legal Assistants typically work in a law office under the supervision of a/an: (Points: 5) attorney. freelancer. judge. legal secretary. Is it "Attorney"
October 6, 2011

Profits for a firm increase by lowering the firm’s __________ costs. (Points: 5) social judicial operating damage Is it "operating"
October 6, 2011

Most management in large law firms is handled by: (Points: 5) judges. legal administrators. systems. contract employees Is it "legal administrators"
October 6, 2011

A garbage can is in the shape of a rectangular prism. The area of the base of the garbage can is 480 square inches. The height of the garbage can is 30 inches. (Part A) how many cubic inches of space are inside this garbage can? (Part B) Explain how you know your answer is ...
September 25, 2011

hw help ASAP
8.00 (in^3) = 131.096512 ml
September 19, 2011

MATH help
The question is really confusing now.. The equation for the dimensions are different and we calculate the x in a different way? From what I see you are saying : the equation of the box is (x)(x+3)=180 when this is put into a Quadratic equation this gives us -15, 12 12 is ...
September 18, 2011

brain teaser
You are standing outside a closed door. On the other side of the door is a room that has three light bulbs in it. The room is completely sealed off from the outside. It has no windows and nothing can get in or out except through the door. On the outside of the room there are ...
September 14, 2011

brain teaser
U2 has a concert that starts in 17 minutes and they must all cross a bridge to get there. All four men begin on the same side of the bridge. You must help them across to the other side. It is night. There is one flashlight. A maximum of two people can cross at one time. Any ...
September 14, 2011

College Basic Math
11. Write as a decimal. 9% a.0.9 b. 0.09 c. 0.009 d. 9 i think its B
September 2, 2011

College Basic Math
Round to nearest hundred? 483.9 a. 400 b. 484 c. 480 d. 500 I think its A
September 2, 2011

real estate law
1. D 2. C
August 6, 2011

real estate law
1. A real estate contract will contain the: (Points: 5) a. credit report of the buyers. b. mortgage information of the sellers. c. hopes and wishes of the buyers. d. terms of the deal. I think is A 2. Most lenders typically require that a borrower purchase __________ insurance...
August 6, 2011

Real Estate Law
Ownership rights that are associated with ownership of property include: (Points: 5) no rights at all. the right to lease it. the right to burn it down. the right to destroy it if someone else wants it. I think its (b)
July 28, 2011

Real Estate Law
Rights that are associated with ownership of property and the effect that these rights may have on property are known as: (Points: 5) interest in property. ownership rights. property. title. I think its (C)
July 28, 2011

Organic Chemistry
Draw and describe the three overall redox reactions than occur in the conversion of 2,6-dimethylnitrobenzene to 2,6-dimethylaniline using stannous chloride. (Not the mechanisms). What are the key structures in these reactions, and what are their oxidation states? What are the ...
July 25, 2011

solve. 0.7x+4<1.1x-7 -
July 25, 2011

f(x)=(-3x^3-x^2-9x-8)/(6x^2+4x+3. Find the equation of the non-vertical asymptote. y= Does f(x) intersect its non-vertical asymptote ? What is the smallest value of x at which f(c) intersects its non-vertical asymptote ? please show all the work. I did this and got the wrong ...
July 21, 2011

THe circumference of a sphere was measured to be 74.000 cm with a possible error of 0.50000 cm. Use the linear appoximation to estimate the maximum error in the calculated surface area. and estimate the relative error in the calculated surface area.
July 19, 2011

If 3000 dollars is invested in a bank account at an interest rate of 6 per cent per year, find the amount in the bank after 12 years if interest is compounded annually Find the amount in the bank after 12 years if interest is compounded quaterly Find the amount in the bank ...
July 13, 2011

i meant x=0
July 13, 2011

Find the volume of the solid formed by rotating the region enclosed by y=(e^(2x))+4,y=0,x-0,x=0.4. I tried doing this but got really confused. Really appreciate it if you guys help.Tnks
July 13, 2011

Wealth and International Trad
Globalization and global trade have led to increased competition in world markets and increased allocation of scarce resources. Is it accurate to say that this is contributing to increased consumer surplus and reductions in inflationary pressures? If yes, how (explain using ...
June 30, 2011

Determine the density of methane (CH4) in g/L at 21.9oC and 0.9 atm
June 29, 2011

Horizontally: Vavg = x/t so t x/Vavg t = 18.4 m/5.5m/s = 3.345 sec Vertically: (parallel to the wall) Assuming initial velocity in this direction is zero Vfinal = Vinitial + at so: Vfinal = 0 + (1.8 m/s^2)(3.345 sec) = 6.0 m/s Using pythagorean theorem to find the final ...
June 23, 2011

Vavg = X/T so T = X/Vavg Car: 140 miles/40 mph = 3.5 hours Coach: 140 miles/30 mph = 4.66 hours So the coach arrive 1.66 hours after the car. .66 *60 = 40 minutes so: The coach arrives at 1:40 pm
June 23, 2011

A triangle is placed in a semicircle with a radius of 3cm, as shown below. Find the area of the shaded region. Use the value for 3.14, and do not round your answer. Be sure to include the correct unit in your answer.
June 14, 2011

what is the velocity of a drop heigh for 50cm 70cm and 80cm thank you I am doing a project on craters
June 14, 2011

The heights of male students in a given university are normally distributed, with a mean of 70 inches and a standard deviation of .5 inches. Find the height (x value) that corresponds to the z value of -1.33.
June 8, 2011

Elementary Statistics
A machine has 7 identical components which function independently. The probability that a component will fail is .2. The machine will stop working if more than three components fail. Find the probability that the machine will be working?
June 8, 2011

The probability of an event can be negative, positive, or zero?
June 8, 2011

If one of the 467 men is randomly selected, what is the probability of getting either an occasional smoker or a regular smoker?
June 8, 2011

a 2d regular box has a perimeter of 200cm determine the maximum possible area
May 25, 2011

In social psychology whats the term that describes this scenario: someone treats you in a certain way then you respond in a certain way consistent with how you were treated. however, that is the way you wanted to act.
May 24, 2011

Double my tens digit to get my ones digit Double me and i am less than 5o.
May 24, 2011

Can someone help me with this problem. When working with behavior disordered children in the classroom, the teacher aide can modify behavior by A praising them whe they succeed B using the same teaching techniques for every student C underestimating what the child can do D ...
May 17, 2011

How do organs get the nutrients from blood?
May 14, 2011

A psychological test was given to 92 teenage boys and 68 teenage girls. The test was used to assign a score to each teenager, measured on the ‘worry scale’ – 0 (not worried) to 100 (very worried). A summary of the results is given in the table below. Girls; ...
May 12, 2011

Using 3(x-3)(x^2-6x+23)^1/2, as the chain rule differentiation of f(x)=(x^2-6x+23). Please explain how I find the general solution to the differential equation dy/dx= 2/27(x-3)SQUARE ROOT BEGINS (x^2-6x+23)/y SQUARE ROOT ENDS (y>0). In implicit form I have an answer of 18*y...
May 12, 2011

Please help with this question. I have a general solution to a differential equation of 18y^3/2= TOP LINE OF FRACTION is 2(x^2-6x+23)^3/2 and this is divided by Constant .I work out constant c to be zero. Is this correct? What is the particular solution for which y=2 ...
May 11, 2011

Please help with this question. I have a general solution to a differential equation of 18y^3/2= TOP LINE OF FRACTION is 2(x^2-6x+23)^3/2 and this is divided by 3. What is the particular solution for which y=2 when x=1. Then I need this particular solution in explicit form. ...
May 11, 2011

error bound
find the bound on the magnitude of the error if we approximate sqrt 2 using the taylor approximation of degree three for sqrt 1+x about x=0
May 8, 2011

What causes the heart to move? Is that movement called a beat?
May 6, 2011

18/20 -6/20+ x/20=1 x=20-18+6 x=8 is this the correct answer
May 5, 2011

25/20 +16/20 +1/20 - x/20 = 1 25+16+1-x=20 x=160
May 5, 2011

May 5, 2011

25/20+16/20+1/20-*/20=1 explain it to me please
May 5, 2011

I need to complete the following number sentences so that the answer to each is 1 12/15 -7/15 + /15 =1
May 5, 2011

12/15 - 7/15 + /15 =1
May 5, 2011

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. Next>>
