Friday
March 6, 2015

Posts by tony


Total # Posts: 839

ci
A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in the general population. A random sample of 90 students at a private high school is tested and and a mean SAT score of 1030 is obtained. The average ...
November 19, 2011

Statistics
A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in the general population. A random sample of 90 students at a private high school is tested and has a mean SAT score of 1050. The average score for ...
November 19, 2011

Math
Use elements in the order given to determine rows and columns of the matrix. R on {1,2,3,4} where aRb means |a-b| <1. R on {1,2,3,4,6,12} where aRb means a|b.
November 18, 2011

math
50 is what percent of 900 (Round to nearest tenth of a percent
November 11, 2011

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011

accounting
prepare the appropriate adjusting entry for the year Rent of $24,000 for a full year was paid on August 31,2011
October 30, 2011

math
(0,2) is correct it is (2,12) not (2,8)
October 28, 2011

Physics
A woman drops a basketball, how far does it fall in one second? use formulas
October 28, 2011

college math
1 __ 5 and 1 __ 20
October 26, 2011

college math
Aging in the United States In 2050, about 1 over 5 of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in 2050. (Source: U.S. Census Bureau.)
October 26, 2011

math
i posted this yesterday and never recieved a answer i do really neeed this help need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. ...
October 26, 2011

math
need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in ...
October 25, 2011

math
need step by step on how we get the answer Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal.(Source: U.S. Census Bureau.)
October 25, 2011

math
question is need for you to show me how you got the answer step by step in order to learn on how to do the other ones.
October 25, 2011

math
need help in solving Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal. (Source: U.S. Census Bureau.)
October 25, 2011

chemistry
calculate the density of oxygen,O/2 under each of the followig conditions-stp,1.00 atm and 35.0 celsius?
October 19, 2011

chemistry
why is the energy difference for t-butylcyclohexane significantly greater than the corresponding value calculated for methylcyclohexane?
October 13, 2011

english
what is a conjunction give example
October 12, 2011

Physics
When finding how high the platform is the horizontal velocity isn't important. S= 1/2at^2 where S is the displacement and a is the acceleration due to gravity (9.8) so S=(1/2) (9.8) 1.7^2 S=4.9*1.7^2 S=14.161 meters When finding how far from the base Janet lands use the ...
October 12, 2011

Finance
assume that $10 million dollars of debt replaces 625,000 shares of common stock. The intrest in the new stock is 11.25 percent what will projected earnings per share be based on the anticipated sales increase of $500,000
October 11, 2011

law
Legal Assistants typically work in a law office under the supervision of a/an: (Points: 5) attorney. freelancer. judge. legal secretary. Is it "Attorney"
October 6, 2011

law
Profits for a firm increase by lowering the firm’s __________ costs. (Points: 5) social judicial operating damage Is it "operating"
October 6, 2011

law
Most management in large law firms is handled by: (Points: 5) judges. legal administrators. systems. contract employees Is it "legal administrators"
October 6, 2011

math
A garbage can is in the shape of a rectangular prism. The area of the base of the garbage can is 480 square inches. The height of the garbage can is 30 inches. (Part A) how many cubic inches of space are inside this garbage can? (Part B) Explain how you know your answer is ...
September 25, 2011

hw help ASAP
8.00 (in^3) = 131.096512 ml
September 19, 2011

MATH help
The question is really confusing now.. The equation for the dimensions are different and we calculate the x in a different way? From what I see you are saying : the equation of the box is (x)(x+3)=180 when this is put into a Quadratic equation this gives us -15, 12 12 is ...
September 18, 2011

brain teaser
You are standing outside a closed door. On the other side of the door is a room that has three light bulbs in it. The room is completely sealed off from the outside. It has no windows and nothing can get in or out except through the door. On the outside of the room there are ...
September 14, 2011

brain teaser
U2 has a concert that starts in 17 minutes and they must all cross a bridge to get there. All four men begin on the same side of the bridge. You must help them across to the other side. It is night. There is one flashlight. A maximum of two people can cross at one time. Any ...
September 14, 2011

College Basic Math
11. Write as a decimal. 9% a.0.9 b. 0.09 c. 0.009 d. 9 i think its B
September 2, 2011

College Basic Math
Round to nearest hundred? 483.9 a. 400 b. 484 c. 480 d. 500 I think its A
September 2, 2011

real estate law
1. D 2. C
August 6, 2011

real estate law
1. A real estate contract will contain the: (Points: 5) a. credit report of the buyers. b. mortgage information of the sellers. c. hopes and wishes of the buyers. d. terms of the deal. I think is A 2. Most lenders typically require that a borrower purchase __________ insurance...
August 6, 2011

Real Estate Law
Ownership rights that are associated with ownership of property include: (Points: 5) no rights at all. the right to lease it. the right to burn it down. the right to destroy it if someone else wants it. I think its (b)
July 28, 2011

Real Estate Law
Rights that are associated with ownership of property and the effect that these rights may have on property are known as: (Points: 5) interest in property. ownership rights. property. title. I think its (C)
July 28, 2011

Organic Chemistry
Draw and describe the three overall redox reactions than occur in the conversion of 2,6-dimethylnitrobenzene to 2,6-dimethylaniline using stannous chloride. (Not the mechanisms). What are the key structures in these reactions, and what are their oxidation states? What are the ...
July 25, 2011

algebra
solve. 0.7x+4<1.1x-7 -
July 25, 2011

CALCULUS HELP !
f(x)=(-3x^3-x^2-9x-8)/(6x^2+4x+3. Find the equation of the non-vertical asymptote. y= Does f(x) intersect its non-vertical asymptote ? What is the smallest value of x at which f(c) intersects its non-vertical asymptote ? please show all the work. I did this and got the wrong ...
July 21, 2011

CAL
THe circumference of a sphere was measured to be 74.000 cm with a possible error of 0.50000 cm. Use the linear appoximation to estimate the maximum error in the calculated surface area. and estimate the relative error in the calculated surface area.
July 19, 2011

Math
If 3000 dollars is invested in a bank account at an interest rate of 6 per cent per year, find the amount in the bank after 12 years if interest is compounded annually Find the amount in the bank after 12 years if interest is compounded quaterly Find the amount in the bank ...
July 13, 2011

Cal
i meant x=0
July 13, 2011

Cal
Find the volume of the solid formed by rotating the region enclosed by y=(e^(2x))+4,y=0,x-0,x=0.4. I tried doing this but got really confused. Really appreciate it if you guys help.Tnks
July 13, 2011

Wealth and International Trad
Globalization and global trade have led to increased competition in world markets and increased allocation of scarce resources. Is it accurate to say that this is contributing to increased consumer surplus and reductions in inflationary pressures? If yes, how (explain using ...
June 30, 2011

chem
Determine the density of methane (CH4) in g/L at 21.9oC and 0.9 atm
June 29, 2011

physics
Horizontally: Vavg = x/t so t x/Vavg t = 18.4 m/5.5m/s = 3.345 sec Vertically: (parallel to the wall) Assuming initial velocity in this direction is zero Vfinal = Vinitial + at so: Vfinal = 0 + (1.8 m/s^2)(3.345 sec) = 6.0 m/s Using pythagorean theorem to find the final ...
June 23, 2011

physics
Vavg = X/T so T = X/Vavg Car: 140 miles/40 mph = 3.5 hours Coach: 140 miles/30 mph = 4.66 hours So the coach arrive 1.66 hours after the car. .66 *60 = 40 minutes so: The coach arrives at 1:40 pm
June 23, 2011

Math
A triangle is placed in a semicircle with a radius of 3cm, as shown below. Find the area of the shaded region. Use the value for 3.14, and do not round your answer. Be sure to include the correct unit in your answer.
June 14, 2011

physics
what is the velocity of a drop heigh for 50cm 70cm and 80cm thank you I am doing a project on craters
June 14, 2011

Statistics
The heights of male students in a given university are normally distributed, with a mean of 70 inches and a standard deviation of .5 inches. Find the height (x value) that corresponds to the z value of -1.33.
June 8, 2011

Elementary Statistics
A machine has 7 identical components which function independently. The probability that a component will fail is .2. The machine will stop working if more than three components fail. Find the probability that the machine will be working?
June 8, 2011

Statistics
The probability of an event can be negative, positive, or zero?
June 8, 2011

Statistics
If one of the 467 men is randomly selected, what is the probability of getting either an occasional smoker or a regular smoker?
June 8, 2011

b-tech
a 2d regular box has a perimeter of 200cm determine the maximum possible area
May 25, 2011

psychology
In social psychology whats the term that describes this scenario: someone treats you in a certain way then you respond in a certain way consistent with how you were treated. however, that is the way you wanted to act.
May 24, 2011

math
Double my tens digit to get my ones digit Double me and i am less than 5o.
May 24, 2011

Teacher
Can someone help me with this problem. When working with behavior disordered children in the classroom, the teacher aide can modify behavior by A praising them whe they succeed B using the same teaching techniques for every student C underestimating what the child can do D ...
May 17, 2011

bio
How do organs get the nutrients from blood?
May 14, 2011

Maths
A psychological test was given to 92 teenage boys and 68 teenage girls. The test was used to assign a score to each teenager, measured on the ‘worry scale’ – 0 (not worried) to 100 (very worried). A summary of the results is given in the table below. Girls; ...
May 12, 2011

Calculus
Using 3(x-3)(x^2-6x+23)^1/2, as the chain rule differentiation of f(x)=(x^2-6x+23). Please explain how I find the general solution to the differential equation dy/dx= 2/27(x-3)SQUARE ROOT BEGINS (x^2-6x+23)/y SQUARE ROOT ENDS (y>0). In implicit form I have an answer of 18*y...
May 12, 2011

calculus
Please help with this question. I have a general solution to a differential equation of 18y^3/2= TOP LINE OF FRACTION is 2(x^2-6x+23)^3/2 and this is divided by 3.plus Constant .I work out constant c to be zero. Is this correct? What is the particular solution for which y=2 ...
May 11, 2011

calculus
Please help with this question. I have a general solution to a differential equation of 18y^3/2= TOP LINE OF FRACTION is 2(x^2-6x+23)^3/2 and this is divided by 3. What is the particular solution for which y=2 when x=1. Then I need this particular solution in explicit form. ...
May 11, 2011

error bound
find the bound on the magnitude of the error if we approximate sqrt 2 using the taylor approximation of degree three for sqrt 1+x about x=0
May 8, 2011

heart
What causes the heart to move? Is that movement called a beat?
May 6, 2011

math
18/20 -6/20+ x/20=1 x=20-18+6 x=8 is this the correct answer
May 5, 2011

math
25/20 +16/20 +1/20 - x/20 = 1 25+16+1-x=20 x=160
May 5, 2011

math
25/20+16/20+7/20-x/20=1
May 5, 2011

math
25/20+16/20+1/20-*/20=1 explain it to me please
May 5, 2011

math
I need to complete the following number sentences so that the answer to each is 1 12/15 -7/15 + /15 =1
May 5, 2011

math
12/15 - 7/15 + /15 =1
May 5, 2011

math
i need to know how to do number sentences 12/15-7/15+/15=1
May 5, 2011

math
Given that 2x + 7 greater than 11, x cannot be equal to?
May 2, 2011

english
14. When one buys insurance, you need to be clear about your needs. __ Pronoun shift in number __ Pronoun shift in person __ Ambiguous reference __ No error
April 24, 2011

business law
what are 3 decision traps that influece human judgment and decision making? legal consequences of falling into the traps?
April 23, 2011

com101
where to find good sources on why renting is a better option than buying
April 22, 2011

physics
A glass window pane is exactly 23 cm by 38 cm at 10oC. By how much has its area increased when it temperature is 49oC, assuming that it can expand freely? Take the coefficient of thermal expansion for the glass to be exactly 9 x 10-6/Co
April 22, 2011

physics
The temperature of 4.60 mol of an ideal monatomic gas is raised 15.0 K in an adiabatic process. What are (a) the work W done by the gas, (b) the energy transferred as heat Q, (c) the change ΔEint in internal energy of the gas, and (d) the change ΔK in the average ...
April 21, 2011

physics
The temperature of 4.60 mol of an ideal monatomic gas is raised 15.0 K in an adiabatic process. What are (a) the work W done by the gas, (b) the energy transferred as heat Q, (c) the change ΔEint in internal energy of the gas, and (d) the change ΔK in the average ...
April 21, 2011

math
60% more than c=1200
April 20, 2011

factorials- 2n!
how does 2n! decrease
April 20, 2011

algebra
it doesnt work, the answer is approximately 2.7% :(
April 10, 2011

algebra
A town has a population of 8400 in 1990. Fifteen years later, its population grew to 12500. Determine the average annual growth rate of this town's population. How do i solve this using applications of exponential functions?
April 10, 2011

chemistry
1. CH3 single bond to N double bond to C double bond to O (Neutral charge all). 1 lone pair on N (2e), 2 lone pairs on O (4 electrons). 2.CH3 single bond to N (positive charge) triple bond to C (neutral) single bond to O (negative charge). 3 lone pairs on O.
April 3, 2011

calculus(work)
a rectangular water tank has a length 20 ft, width 10 ft , and depth 15 ft . if the tank is full , how much work does it take to pump all the water out (using calculus)?
April 2, 2011

english
he prolonged it
March 31, 2011

Finance
$29.18 I have a BBA in Finance and take courses for students. Message me at randall.a.neal(at)gmail(dot)com if interested.
March 30, 2011

math
find the percent notation for 0.046
March 29, 2011

Math
30 years = 90,136.80 15 years = 70,237.80 19,899 is the difference I have a BBA in finance and take courses for students. If interested, email me at randall.a.neal(at)gmail(dot)com
March 28, 2011

Calculator help
can someone tell me how to graph this equation on my graphing calculator: 300(2+sin(4sqrt x+0.15)) for 0<x<20
March 27, 2011

geometry
how to turn volume into gallons
March 25, 2011

math
how would you do this problem 25/40x=50
March 15, 2011

math !!!! :O
$5.10, calculated as follows: $.02 + $.04 = $.06 + $.08 = $.14 +$.16 = $.30 + $.32 = $.62 + %,64 = $1.26 + $1.28 = $2.54 + $.56 = $.10
March 14, 2011

IV help
What is the drip rate for infusing an IV at a KVO rate using a 60 ttys/mL administration set?
March 9, 2011

Physics
each electron has a magnitude of charge 1.602*10^-19. So, divide the excess charge by the single electron charge to get a number of electrons. (3.1*10^-6 Coul)/(1.602*10^-19 Coul/e) = 1.9 *10^13 excess electrons.
March 7, 2011

Organic Chemistry Lab
a)If the Keq for the esterification of acetic acid with isopentyl alcohol is 3.0, what is the maximum amount of isopentyl acetate that can be recovered at equilibrium if a 1:1 mole ratio of alcohol was used? b)If a 1:5 mole ratio was used? c) 5:1 mole ratio?
March 5, 2011

math
How do you change 12d=60 into an linear enquality using either < or >?
March 2, 2011

Chemistry
What is the molality of a solution composed of 11.1 g NaCl dissolved in 638 g of water? Answer in units of m.
March 2, 2011

finance
$20.06 (if this year is supposed to be 2011) I have a BBA in Finance and take courses for students. If interested, email me at randall.a.neal(at)gmail(dot)com
February 25, 2011

social studies
Do you think many people live on the Kamchatka Peninsula ? Why or why not? My answer is no because there are 160 volcanoes and 29 are active.
February 22, 2011

social studies
Do you think many people live on the Kamchatka Peninsula? Why or Why not
February 22, 2011

Chemistry
What is the pOH of a solution which has a [H+] = 1.0 × 10¯³M?
February 9, 2011

Finance
Pearson Brothers recently reported an EBITDA of $9.0 million and net income of $2.7 million. It had $2.34 million of interest expense, and its corporate tax rate was 40%. What was its charge for depreciation and amortization? Could I get someone to help me on setting this up. ...
February 7, 2011

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | Next>>

Members