Friday
December 9, 2016

Posts by maria

Total # Posts: 1,940

geometry
thanks :) :D
December 9, 2016

geometry
Prove that the angle bisectors of the base of the isosceles angles of the isosceles triangle are congruent using statement and reason proof i dont really now how to prove this problem but i now what a transversal is and the angles of a trashes line. can u guys plz solve and ...
December 9, 2016

math
thank you !!!!!!!!!!! :)
December 9, 2016

math
find the image of S(-1,-3) after a reflection scross the line y=-2
November 17, 2016

Office finances
6. What must a depositor add to a check before the bank will accept it for deposit? A. Cancel B. Void C. Endorsement D. Date of deposit
November 16, 2016

chemistry
Pl help...what are the isomers of chlorodibromobenzene
November 15, 2016

chemistry
what are the isomers of chlorodibromobenzene
November 15, 2016

Chemistry
What are the isomers of chlorobromobenzene
November 15, 2016

Physics
If you reduce the distance between two point charges to one third of the original distance, the electromagnetic force changes by a factor of:
November 14, 2016

accounting
provided accounting services to dress shop $8,500. payment to received on july 9th how would this journal entry be posted to the general journal.
November 13, 2016

Accounting
Rented an office and paid three months rent in advance to property Management check #001 $4,500. How would this journal entry be posted to the general journal.
November 12, 2016

accounting
Invested $19,000cash in the business along with $6,000 of office equipment. How would this journal entry be posted to the general journal.
November 11, 2016

intermediate algebra
a cyclist bikes at a constant speed for 19 mile. He then returns home at the same speed but takes a different route. His return trip takes one hour longer and is 24 miles. Find his speed
November 8, 2016

Math HELP HELP
Express the following in completed square form. x^2+4x-41
November 8, 2016

social studies
how did the siege at the Alamo influence the response of the Texas settlers? it force them to recruit native Americans it forced them to surrender it strengthened their resolve to fight*** it prompted them to have public forums
November 4, 2016

precalculos
The cost C of producing x thousand calculators is given by the following equation. C=-15.2x^2+15,990x+580,000(x??175) Find the average cost per calculator for each of the following production levels. 40,000?; 60,000? and 175,000
November 3, 2016

Chem
A gas is used to fill a container up, there are 17.8 moles. What will be the new volume of the gas in the container at STP? (I don't understand which gas law to use)
October 28, 2016

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...
October 28, 2016

Math
Suzanne bought 50 apples at the apple orchard. She bought 4 times as many red apples as green apples. How many more red apples than green apples did Suzanne buy?
October 27, 2016

El Paso Community College
What are the joules needed to melt 50.0g of ice at 0 degree C and to warm the liquid to 65.0 degree C?
October 27, 2016

maths percentage
in a 400ml can of mixed juice, 41% is MAngo Juice, 3205% is pineapple juice and the rest is water. find the volume of Mango, pineapple and water ?
October 23, 2016

Chemistry
1.15gm
October 22, 2016

Chemistry
A chemist reacted 0.05 mol of sodium with water to form 50cm3 of sodium hydroxide what was the mass of sodium reacted Na+h2p-Noah+h2
October 22, 2016

Math
I walked 2/7 of a mile in 4/9 of an hour. at this rate, how far will I have traveled after an hour?
October 14, 2016

History Social studies
1. Which activity is part of both private and civic life? (1 point) learning about politics •• voting for a candidate going to sports games working at a bookshop 2. Why are elections necessary for good governance? (1 point) Elected officials can be fired at any time...
October 13, 2016

Math
A situation that could describe the ratio 52 to 12.
October 13, 2016

Social studies
Warsaw Pact United Nations<-- League of Nations British commonwealth North Atlantic treaty organization <--
October 12, 2016

Social studies
To which internatinal associations does the United States belong to?
October 12, 2016

History
Of the following choices which ones are considered democratic values? Select all that apply A. Serving in the military*** B. Honesty C. Patriotism D. Voting in an election ••
October 12, 2016

Algebra
Identify and interpret the decay factor for each of the following. a.) P= 400×(0.43)^t decay factor: 0.43 This means that the function decays by ___?___ % b.) f(t)= 3800×(0.84)^t decay factor: 0.84 This means that the function decays by ___?___ % c.) y= 21×(2...
October 12, 2016

English
No I don't know them.
October 8, 2016

English
The other questions didn't tell me the answers to these questions. Thank you for the suggestion though.
October 8, 2016

English
Need these answered soon please! 10.   The author of “My Brother’s Keeper” emphasizes Jamie’s conflict by describing the car accident in detail.*** detailing Jamie’s physical appearance and good grades. flashing back to earlier events with ...
October 8, 2016

Math precalculus
The revenue for a sale of x books at $80 each is given by R(x) = 80x. The commission for a revenue of x dollars is given by C(x) = 0.30x. Express the commission as a function of the number of books sold
October 2, 2016

American government
how does the president limit the legislative power of congress. a- by appointing congressional committee chairs b- by appropriating congressional spending c- by administering the law d- by using the veto
September 30, 2016

Georgia History
1. At which meeting was Georgia not represented? A.) Provincial Congress B.) First Continental Congress C.) Second Continental Congress D.) Council of Safety I think B Please help asap :)
September 27, 2016

math
write a program that takes an integer n and output the largest odd divisor of n
September 27, 2016

Chemistry
Dr. Bob222 I still didn't understand which is the reduction half reaction and its products and oxidation half reaction...and why is it O3 to IO3-...0 to -6 and then Please help...entrance exam soon Write the oxidation and reduction half reactions(showing e- lost or gained...
September 26, 2016

chemistry
Calculate energy change that produced the 4th line in lyman series
September 26, 2016

Chemistry
Please help...entrance exam soon Write the oxidation and reduction half reactions(showing e- lost or gained) for the foll O3 + I- -> IO3- + O2 (acidic)
September 24, 2016

Math
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the other digits is used twice is four times the hundreds digit 10 digit is the difference of the ones digit in the hundred digit is the same digit ...
September 21, 2016

Math
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the other digits is used twice is four times the hundreds digit 10 digit is the difference of the ones digit in the hundred digit is the same digit ...
September 21, 2016

Math HELP HELP
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.
September 21, 2016

Math
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.
September 20, 2016

Culturel Diversity
Talking the talk emphasizes the use of lableing individuals positivly
September 18, 2016

Chemistry
CHCl3 + MnO4- = Cl2 + CO2 + Mn+2 Balance the above with half reactions in acidic medium. For the above reaction, can you please show the half reactions...which is getting oxidised...both C and Cl's oxidation # are changing showing both getting oxidised,.how is this ...
September 16, 2016

CHEMISTRY
BALANCE THE REDOX REACTION USING HALF CELL METHOD IN AN ACIDIC MEDIUM CHCl3 + MnO4- = Cl2 + CO2 + Mn+2
September 15, 2016

Chemistry
Half reaction method of balancing redox reaction CHCl3 + MnO4- = Cl2 + CO2 + Mn+2
September 15, 2016

Math
24 dogs line up for breakfast. The first cat eats one fish, the second cat eats two fish, and so on, with each cat eating one more fish than the one before it. How many fish are eaten in total.
September 15, 2016

Social studies
Type of American Indian dwelling in the Eastern Woodlands
September 12, 2016

English
Man-Made
September 12, 2016

chimistry
natriumsaltet
September 10, 2016

chimistry
hvorfor løsligheten av natriumsaltet til salsyre vann
September 10, 2016

chemistry
a) What is fellesioneffekten?   Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a variety of drug classes, including sleep medications (hypnotikasedativa), in painkillers (anesthetics) and anticonvulsants. A barbiturate is ...
September 9, 2016

chemistry
a) What is fellesioneffekten?   Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a variety of drug classes, including sleep medications (hypnotikasedativa), in painkillers (anesthetics) and anticonvulsants. A barbiturate is ...
September 9, 2016

chemistry
In quality control of raw materials for pharmaceutical production often used foul reactions to prove that raw materials in salt form containing the appropriate salt. Hydrochloride (eg. Amitriptyline hydrochloride) can be detected for example by precipitating the chloride ions...
September 9, 2016

chemistry
Cocaine is a weak base (Figure see below) with pKb = 5.59. Cocaine has local anesthetic effect (local anesthetic) but is also a narcotic.   a) Calculate the ratio of the concentration of cocaine and its conjugated acid in a solution which has. pH = 7.40 (that of blood) ...
September 9, 2016

chemistry
To create a 0.1 M carbonate buffer pH = 10.2. You choose to use a combination of HCO3- / CO32-. This buffer system has pKa = 9.9.   a) Calculate how much you need to weigh in each of the sodium salts, NaHCO3 and Na2CO3, to create 1.0 L carbonate (with total concentration ...
September 9, 2016

chemistry
a) Hva er fellesioneffekten? Veronal er et barbiturat (struktur se over). Barbiturater er en stoffklasse som forekommer i en rekke legemiddelgrupper, blant annet i sovemedisiner (hypnotikasedativa), i smertestillende (anestetika) og i antiepileptika. Et barbiturat er en svak ...
September 9, 2016

chemistry
Calculate the pH reaches 30.0 mL one 0.200 M solution of HCl salt of amitriptyline is added 100.0 mL of a NaOH solution of concentration 80 mM.
September 9, 2016

chemistry
Calculate the pH at 25 ° C when 120 mL of a HCl solution having a concentration of 50 mM is added 50.0 mL of a 120 mM ephedrine solution. Assume no change in temperature.   Amitriptyline is a drug used in treating depression. It is typically formulated as the ...
September 9, 2016

chemistry
presentation Tasks:  Ephedrine (structure see below) is a natural product that is used as a medicine in the treatment of asthma. The corresponding acid to ephedrine have pKa = 9.60 at 25 ° C.   Question:  Calculate the pH reaches 991 mg ephedrine ...
September 9, 2016

Maths
Ahmed says that there are 70 sweet in the box to the nearest 10 what is the least number of sweets that could be in the box
September 6, 2016

Maths
A plane setts off from airport A and flies due east for 100 km, then turns to fly due south for 80 km before landing at an airport b show that the approximate bearing of airport b from airport a is 129
September 3, 2016

History
Thanks!!
August 29, 2016

History
Which of these words best describes a merchant? A. Explorer B. Middleman C. Monarch D. Slave I have having trouble between Explorer and middleman... I think it is B.
August 29, 2016

biology
Color blindness is a defect in vision of colors, this defect is due to a localize-homologous segment of chromosome X. In the document I have a pedigree which the parents and their children are normal; but then most of the children got married to a diseased one which 50% ...
August 25, 2016

Math
In the cafetería,100 milk cartons were put out for breakfast at the end of breakfast 27 remained. What Is the ratio of the Number of milk cartons taken to the total Number of milk cartons?
August 23, 2016

Pre Calculus
Two forces with magnitudes of 150 and 75 pounds act on an object at angles of 30° and 150°, respectively. Find the direction and magnitude of the resultant force. Round to two decimal places in all intermediate steps and in your final answer. Having lots of trouble ...
August 18, 2016

Math
What do you do when you have for sale factor 0.5 and 0.25
August 10, 2016

Geometri euclid
The small circle and the large circle have the same center O. Chord AB is tangent to the smaller circle at C. Prove that the area between the large and small circle is the same as the area of the circle that has AB as a diameter
July 30, 2016

chemistry
Assuming all gases are at the same temperature and pressure, how many milliliters of hydrogen gas must react to give 41.0 mL of NH3? 3H2(g)+N2(g)→2NH3(g)
July 20, 2016

Chemistry
A typical antacid contains CaCO3. If such an antacid is added to 25.0 mL of a solution that is 0.250 M in HCl, how many grams of CO2 gas are produced?
July 17, 2016

Chemistry
A patient received 5.0 g of NaCl in 8 hours. How many milliliters of a 0.40 % (m/v) NaCl (saline) solution were delivered?
July 17, 2016

chemistry
Calculate the grams or milliliters of solute needed to prepare the following solutions. 1.)75. g of a 7.0 % (m/m) KCl solution 2.) 1250 mL of a 8.0 % (m/v) NH4Cl solution 3.) 270. mL of a 15.0 % (v/v) acetic acid solution I really just need to know how to work the first ...
July 17, 2016

chemistry
Solubility (g/100gH2O) Substance 20∘C 50∘C KCl 34.0 42.6 NaNO3 88.0 114.0 C12H22O11 (sugar) 203.9 260.4 Using the above table, determine whether each of the following solutions will be saturated or unsaturated at 50 ∘C. 1.) Adding 19.7 g KCl to 35.0 g H2O 2.)...
July 17, 2016

chemistry
What volume of 0.10 M NaOH can be prepared from 250. mL of 0.30 M NaOH? A) 0.075 L B) 0.25 L C) 0.75 L D) 0.083 L E) 750 L
July 15, 2016

chemisrty
Which one of the following compounds will NOT be soluble in water? A) NaOH B) Na2S C) K2SO4 D) LiNO3 E) PbO
July 15, 2016

Probability and statistic
Suppose the counts recorded by a Geiger counter follow a Poisson process with an average of two counts per minute. Round the answers to 3 decimal places. (a) What is the probability that there are no counts in a 30-second interval? (b) What is the probability that the first ...
July 1, 2016

college algebra
in a class of 30 students all of them are either female or smokers. while only 5 are female and smokers. if there are 12 male smokers in the class, then how many female nonsmokers are in the class?
June 15, 2016

Math
Wait, I figured it out, you do 36%.
May 18, 2016

Math
52%, 36%, or 12%??
May 18, 2016

Math
A survey showed that 36% of car owners prefer two door cars, 52% prefer four door cars, and 12% have no preference. You ask 300 people. How many do you think will prefer the two door cars.
May 18, 2016

Math
That would be 5.
May 18, 2016

Math
the probability of winning a game is 25%. how many times should you expect to win if you play 20 times.
May 18, 2016

Math
from a barrel of colored marbles, you randomly select 5 blue, 2 yellow, 3 red, 4 green, and 2 purple marbles. Find the experimental probability of randomly selecting a marble that is not yellow.
May 18, 2016

science
Calculate the kinetic energy in joules of a body of mass 30kg at a velocity of 3ms-1
May 13, 2016

language arts
which sentence best describes the employer in the original story "the ninny" and the employer in the adaptation the governess
May 10, 2016

math
ms.sue is right
May 10, 2016

Science
How test tube babies are born?
May 6, 2016

Math
2.A. 6,501.5 * 1000 = 6,501, 500
May 6, 2016

English
Yes . She got on the bus to school every day. Its correct
May 6, 2016

Geography
I NEED help on the introduction
May 5, 2016

Geography
I need help with my introduction and topics for my five paragraph essay on why the stamp act was not fair.
May 5, 2016

life orientation
I don't have any idea how can i answer this question..can you please help me
May 4, 2016

English
thank you so much here if anything
May 2, 2016

life orientation
Right to have free movement
April 20, 2016

life orientation
3 human rights violation?
April 20, 2016

Calculus 1
Find the formula for a function of the form y=bxe^(-ax) with a local maximum at (4,12)...
April 13, 2016

algebra
a 38 inch piece of steels is cut into three pieces so that the second piece is twice as long as the first piece, and the third piece is three inches more than four times the length of the first piece. find the lengths of pieces.
April 4, 2016

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>