May 30, 2015

Posts by bio

Total # Posts: 15

In an experiment to show the relationship between substrate concentration and activity of enzymes, why do we add a 0.5 of a 5 pH buffer solution to the enzyme test groups? the test tubes that we use to stop the reaction at specific times are basic solutions of 5.5 mL NAOH.
September 20, 2014

A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?
September 18, 2014

To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...
August 8, 2014

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...
August 7, 2014

August 5, 2014

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)
August 5, 2014

The Cell membrane contains A) a double layer of fatty acid tails and phosphate heads B) cholesterol C) protein channels or pores D) a and b E A,B, and C
May 3, 2012

Why do you suppose Streptomyces griseus produces an enzyme that inactivates streptomycin? Why is this enzyme produced early in metabolism?
March 27, 2012

what are significants of Evolution of Eukaryotes ?
February 10, 2008

Hey corey, how did you figure that out?
October 21, 2007

True or False: The multi-cellular stage in the life cycle of a fungus is haploid. Yes, true. And to make it more interesting, there is a species of fungi that live in symbosis with orchid seeds (which have no ...
March 8, 2007

Low levels of calcium ions in the blood cause what? Low calcium can cause several things: Mucsle weakness and twitching Numbness of fingers and toes Seizures Heart arrhythmias (abnormal beating of the heart)
October 31, 2006

In an industrial accident, a sharp fragment of metal entered the head of a worker and lodged in the bony area where the vestibular branch of the auditory nerve leaves the ear. In order to evaluate what nerve damage had been done, doctors blindfolded the worker and strapped him...
October 30, 2006

Poetry, part 2
Hopkin's use of "seared", "bleared", and "smearded" is an example of You are probably looking for a grammatical which my mind is blank. But in poetry, rhythm usually sets the poem style, the use of seared, bleared, and smeared is ...
October 14, 2006

1)what process must occur between the F1 parents and the F1 gametes? 2)What process occurs between the gametes to poduce the F1 or F2 stage? 1) 2)
July 9, 2006

  1. Pages:
  2. 1
