Post a New Question

Posts by bio

Total # Posts: 15

Kim
In an experiment to show the relationship between substrate concentration and activity of enzymes, why do we add a 0.5 of a 5 pH buffer solution to the enzyme test groups? the test tubes that we use to stop the reaction at specific times are basic solutions of 5.5 mL NAOH.

biology
A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?

BIOCHEMISTRY
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...

biology
Ter?

biology
so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)

biology
The Cell membrane contains A) a double layer of fatty acid tails and phosphate heads B) cholesterol C) protein channels or pores D) a and b E A,B, and C

Microbiology
Why do you suppose Streptomyces griseus produces an enzyme that inactivates streptomycin? Why is this enzyme produced early in metabolism?

bio
what are significants of Evolution of Eukaryotes ?

Chemistry
Hey corey, how did you figure that out?

biology
True or False: The multi-cellular stage in the life cycle of a fungus is haploid. http://staff.jccc.net/PDECELL/celldivision/lifecycles.html#fungi Yes, true. And to make it more interesting, there is a species of fungi that live in symbosis with orchid seeds (which have no ...

bio!
Low levels of calcium ions in the blood cause what? Low calcium can cause several things: Mucsle weakness and twitching Numbness of fingers and toes Seizures Heart arrhythmias (abnormal beating of the heart)

bio
In an industrial accident, a sharp fragment of metal entered the head of a worker and lodged in the bony area where the vestibular branch of the auditory nerve leaves the ear. In order to evaluate what nerve damage had been done, doctors blindfolded the worker and strapped him...

Poetry, part 2
Hopkin's use of "seared", "bleared", and "smearded" is an example of You are probably looking for a grammatical term....to which my mind is blank. But in poetry, rhythm usually sets the poem style, the use of seared, bleared, and smeared is ...

biology-genes
1)what process must occur between the F1 parents and the F1 gametes? 2)What process occurs between the gametes to poduce the F1 or F2 stage? 1) http://en.wikipedia.org/wiki/Meiosis 2) http://www.answers.com/topic/fertilization

  1. Pages:
  2. 1

Post a New Question