Sunday
December 21, 2014

Posts by Tony


Total # Posts: 821

Math ( Can You check my Work?)
1.an = 3n - 1 2. an = 2(2n - 3) 3.an = 4^n 4.an = (2/3)^n 5. an = (-1)^n(n + 5) 6. an = (-1)^n + 1(n + 6) 7. an= n+3/2n-1 8. a1 = -5 and an = an-1 - 3 for n ≥ 2 9. a1 = -6 and an = -2an-1 for n ≥ 2 10.a1 = 4 and an = 3an-1 + 2 for n ≥ 2 11. Find a8 when a1...
August 1, 2012

math
A radio transmission tower is 170 feet tall. How long should a guy wire be if it is to be attached 7 feet from the top and is to make an angle of 30° with the ground? Give your answer to the nearest tenth of a foot
July 28, 2012

Math ( i just need these two to finish my workshet
Show the solutions of 1. If a = 4, b = 3, and A = 36o. 2. If a = 3, b = 4, and A = 48.59o Finding a "solution" means solving for all missing sides and angle measures in each triangle.)
July 28, 2012

readings in world civilization
The answer is one that you must learn for yourself my friend...
July 26, 2012

Math i dont understand
Window: [-4π , 4π , 1] [-10,10,1] State the Period, Amplitude, Phase Shift, Vertical Shift and Equation in cosine for #5 Number five is a graph is there a way i can show u it i think its valuable for the help on this question
July 21, 2012

Math ( I Dont understand)
A Amplitude: Maximum y-coordinate – minimum y-coordinate divided by 2 ( Max y – Min y)/2 B Adjustment for period change: B = 2 Period π C Phase shift: Right or left x - transformation D Vertical shift: Maximum y-coordinate + minimum coordinate divided by 2 ( Max...
July 21, 2012

Math ( I Dont understand)
f(x) = A sin(B(x - C)) + D or f(x) = A cos(B(x - C)) + D thats the equation
July 21, 2012

Math ( I Dont understand)
State the Period, Amplitude, Phase Shift, Vertical Shift, and equation (using cosine
July 21, 2012

Math
an = 3n - 1 Answer 2, 3, 4, 5 2, 5, 8, 11 -2, -5, -8, -11 4, 7, 10, 13 3 points Question 2 Write the first four terms of the sequence whose general term is given. an = 2(2n - 3) Answer -6, -2, 2, 6 -1, 1, 3, 5 -2, -4, -6, -8 -2, 2, 6, 10 3 points Question 3 Write the first ...
July 17, 2012

Math
In 1983, the population of Functionville was 2560, and it tripled in 6 years. a. Write an exponential model for the population of Functionville t years after 1983. b. According to your model, it what year had the population grown to 7 times its size?
July 15, 2012

Math
Use the compound interest formulas A = P(1 + r/n)nt and A = Pe^rt to solve. Find the accumulated value of an investment of $3000 at 9% compounded continuously for 3 years.
July 15, 2012

Math please help with these word problems i have
thank yall so much
July 13, 2012

Math please help with these word problems i have
1.360pie *2r 2.Area+4L 3.4x(4s) 4.f=M+A 5.P(u) 6. x=3.95*x 7. 13.45*Fbs 8. x*2yz/72 9. L/20f+W 10. 2x(2x+2)=W 11. ? 12. ? Sorry i suck at these
July 13, 2012

Math please help with these word problems i have
1. The circumference of a circle is the product of the number π and twice the radius. 2. The area of a square is the square of the length of a side. 3. The perimeter of a square is four times the length of a side. 4. Force equals the product of mass and acceleration. 5. ...
July 13, 2012

Math PLEASE HELP PLEASE PLEASE PLEASE
Question 1 Write the first four terms of the sequence whose general term is given. an = 3n - 1 Answer 2, 3, 4, 5 2, 5, 8, 11 -2, -5, -8, -11 4, 7, 10, 13 3 points Question 2 Write the first four terms of the sequence whose general term is given. an = 2(2n - 3) Answer -6, -2, ...
July 10, 2012

CRITICAL THINKING
What are your thoughts about overthinking and under thinking?
July 8, 2012

Math
Why is the asymptote of the function in Example #1 y=2 ? ( y = 4x+3 + 2 )
July 7, 2012

Math
f(x) = (x - 0.6)2 + .66. turn into h/k form what is the quadratic regression equation using your calculator
July 7, 2012

ELECTRIC APPLIANCE TOOLS AND TESTERS
An important safety precaution you should take before starting any electrical servicing job is to make sure that your
July 6, 2012

Math
Among all pairs of numbers whose difference is 88, find a pair whose product is as small as possible.
July 5, 2012

Math
In one U.S. city, the quadratic function models the median, or average, age, y, at which men were first married x years after 1900. In which year was this average age at a minimum? (Round to the nearest year.) What was the average age at first marriage for that year? (Round to...
July 5, 2012

Math
A developer wants to enclose a rectangular grassy lot that borders a city street for parking. If the developer has 344 feet of fencing and does not fence the side along the street, what is the largest area that can be enclosed?
July 5, 2012

Math
farmer wants to enclose his pasture which is bordered by a river. If he uses 750 feet of fencing on three sides of the field, what is the largest area he can enclose?
July 5, 2012

physics
in a hypothetical thermometer, the freezing point of water is marked as -10 and the boiling point is marked at 70. What would be the reading if this thermometer is used to measure the temperature of 50 degree water?
June 17, 2012

physics
i completely drew a blank on the equation.....so easy Damon...thanks for your help Answer is 6250 cal?
June 17, 2012

physics
got 22 degrees celsius for the last answer from Damon. Another question is ......How much heat is needed to raise the temperature of a 500g object with specific heat capacity 0.5 cal/g c by 25 degrees?
June 17, 2012

physics
what is the equilibrium temperature if 100 grams of water at 20 degrees celsius is added to 50 grams of water at 62 degrees celsius in an insulated container of negligible mass?
June 17, 2012

algebra
Of the two fractions 15/21 and 19/17 which is smaller? I think its 19/17 but need someone to double check please.
May 30, 2012

algebra
Convert the fraction 8/17 to a decimal. Can you show me how to do this?
May 30, 2012

geometry
Find the surface area and the volume of a sphere whose radius equals 4?
May 15, 2012

math
80
May 15, 2012

math
If you toss a coin three times in a row, what is the probability of getting a head, a tail, and then a head? 1/2*1/2*1/2= 0.125 ????
April 26, 2012

A level, Mechanics
An object of mass 100 kg is suspended by two identical cables. The tension in cable one is (400i + 300j)N, where i and j are horizontal and vertical unit vectors respectively. The tension in cable two is (pi + qj)N. If the object remain at rest, find p and q
April 19, 2012

math
A cable weighing 2 lb/ft is 16 ft long. If a 20-lb weight is attached to the end, find the work done in winding up the chain.
April 18, 2012

grade 6 math
how many rectangles can have the perimiter of 46m
April 16, 2012

economics
what is the answer to this????
April 16, 2012

College Physics 2056
Figured it out. E/SA=t 1000/[(2.38e14*B^2)*(Area)]= t
April 8, 2012

College Physics 2056
An electromagnetic wave strikes a 3.00-cm2 section of wall perpendicularly. The rms value of the wave's magnetic field is determined to be 6.00 10-4 T. How long does it take for the wave to deliver 1000 J of energy to the wall?
April 8, 2012

6th G Math
Find the area of one rectangle flag. 7in x 8in = ? Divide the area by 2 (because half of the flag is white, the other half is red) That is the area of one white triangle. You need 100 flags so multiply that number by 100. _____ in^2 of fabric
April 7, 2012

health
all of the following conditions were responsible for the majority of premature deaths in the early 1900's except
April 7, 2012

english
the snow is so deep mean?
April 7, 2012

english
what is the personification of this sentence The wind whispered through the dark and gloomy forest.
April 6, 2012

AQA Mechanics (M1), Statics and forces, please hel
A particle of weight W is attached by a light inextensible string of length a to a point A on a verticle wall. The particle is supported in equilbrium by a light rigid strut of length b attached to a point B on the wall at a distance a vertically below A. Show that the tension...
April 1, 2012

grammar
Apa MLA Supposed Their
March 30, 2012

chemistry
72.97
March 26, 2012

M1, Mechanics
A particle of mass 4kg is suspended from a point A on a vertical wall by means of a light inextensible string of length 130cm.A horizontal force P, is applied to the particle so that it is held in equilibrium a distance of 50cm from the wall. Find the value of P and the ...
March 19, 2012

HVAC
Why must all valves be open when an evacuation is performed?
March 18, 2012

Chemistry
How many electrons are in oxide and in oxygen
March 14, 2012

math
Find the coordinates of the x-intercept. 2x + y = -6
March 11, 2012

American Government
its 3
March 5, 2012

math
A pie chart of total number of students in a school has a sector 35degree representing 14students.how many students are there in the school altogether?
February 24, 2012

chemistry
Thank you I been trying to really get the first three I think I figured out the rest through your help thanks.
February 11, 2012

chemistry
Calculate the following: (a) mass of water in the hydrate sample (g): (b) number of moles of water in the sample: (c) mass of pure salt in the sample (g): (d) number of moles of salt in the sample: (e) molar ratio of water to salt in the sample: If the mass of the empty ...
February 11, 2012

algebra
A taxi driver charges a flat rate of $3.00 and $0.08 per mile traveled
February 11, 2012

math at
Mary has read 1/3 of a 240-page book. How many pages does she still have to read to finish the book? What percent of the book does she still have to read?
February 9, 2012

budgeting
Throw out the high and low values and average the remaining factors
February 8, 2012

Medical Terminology
Why is it so important to know terms that are associated with all of thedifferent body systems even if you were to only work with onesystem?
February 6, 2012

vocabulary
need root or base word
February 5, 2012

vocabulary
levity
February 5, 2012

vocabulary
when would you not use it
February 5, 2012

vocabulary
it doesn't have the root word
February 5, 2012

vocabulary
answer each question based on your understanding of the boldfaced vocabulary what are some situation when levity is out of place
February 5, 2012

vocab
whats the root or base word of rebellious,belligerent, doctrine, document, levity, levitate, initiative, itinerary, impulsive, compel
February 5, 2012

Chemistry
Please help me with question #2: How do you determine if there is a linear relationship between NaCO3 used and CO2 produced?Discuss your results in terms of moles. Thank you!! Question #1 : 1. Record the amount of CO2 produced versus the amount of Na2CO3 used. Answer : 1.The ...
January 20, 2012

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

4thGrade Math
8.8 inches
January 19, 2012

Chemistry
Please help me with the questions at the end of this chemistry lab.Thank you for any help you can provide. 1. This experiment requires you to do 7 trials with varying amounts of Na©üCO©ý. 2. Take a clean 50 mL beaker from the Glassware shelf and place it ...
January 19, 2012

geometry
find the coordinates of the circumcenter of tringleABC A(3,-1),B(-2,-1),C(3,-8)
January 13, 2012

Physics
You are driving your car and the traffic light ahead turns red. you apply the breaks for 3.0 s, and the velocity of the care decrease for +4.5 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 11, 2012

Science
You are driving you car and the traffic light ahead turns red. you apply the breaks for 3.0s, and the velocity of the care decrease for +45 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 10, 2012

Science
What is the magnitude of the average acceleration of a skier who, starting from rest, reachers a speed of 8.0m/s when going down a slope for 5.0 s? how far does the skier travel in this time?
January 10, 2012

Anthropology
Whsy
December 15, 2011

math
Ken paid $8.50 for tickets an adult paid $2.00 more than a child how much does the adult pay
December 1, 2011

Math
C?
November 29, 2011

Math
I dont know how to simplify
November 29, 2011

Math
A box contains 1 white bow, 2 yellow bows, 3 red bows, and 6 green bows. The bows are all the same size and shape. If Patricia reaches in the box and pulls out a bow without looking, what is the probability that it will be yellow? A.1/12 B.2/10 C.1/6 D.1/4
November 29, 2011

math
Thanks that is what i did but i wasn't sure if i had to include the extra 1/2 sheet in my answer.
November 22, 2011

math
thank you. would you know how to draw that out in pictures. I have to use a picture. thank you
November 22, 2011

math
in art class there are 5 sheets of drawing paper for 9 people. how much paper will each person get?
November 22, 2011

math
Joyce took out a loan for $21,900 at 12 percent on March 18, 2007, which will be due on January 9, 2008. Using ordinary interest, Joyce will pay back on Jan. 9 a total amount:
November 20, 2011

business math
Matty Kaminsky owns a new Volvo. His June monthly interest was $400. The rate is 8 ½ percent. Matty's principal balance at the beginning of June is: (Use 360 days)
November 20, 2011

ci
A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in the general population. A random sample of 90 students at a private high school is tested and and a mean SAT score of 1030 is obtained. The average ...
November 19, 2011

Statistics
A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in the general population. A random sample of 90 students at a private high school is tested and has a mean SAT score of 1050. The average score for ...
November 19, 2011

Math
Use elements in the order given to determine rows and columns of the matrix. R on {1,2,3,4} where aRb means |a-b| <1. R on {1,2,3,4,6,12} where aRb means a|b.
November 18, 2011

math
50 is what percent of 900 (Round to nearest tenth of a percent
November 11, 2011

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011

accounting
prepare the appropriate adjusting entry for the year Rent of $24,000 for a full year was paid on August 31,2011
October 30, 2011

math
(0,2) is correct it is (2,12) not (2,8)
October 28, 2011

Physics
A woman drops a basketball, how far does it fall in one second? use formulas
October 28, 2011

college math
1 __ 5 and 1 __ 20
October 26, 2011

college math
Aging in the United States In 2050, about 1 over 5 of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in 2050. (Source: U.S. Census Bureau.)
October 26, 2011

math
i posted this yesterday and never recieved a answer i do really neeed this help need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. ...
October 26, 2011

math
need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in ...
October 25, 2011

math
need step by step on how we get the answer Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal.(Source: U.S. Census Bureau.)
October 25, 2011

math
question is need for you to show me how you got the answer step by step in order to learn on how to do the other ones.
October 25, 2011

math
need help in solving Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal. (Source: U.S. Census Bureau.)
October 25, 2011

chemistry
calculate the density of oxygen,O/2 under each of the followig conditions-stp,1.00 atm and 35.0 celsius?
October 19, 2011

chemistry
why is the energy difference for t-butylcyclohexane significantly greater than the corresponding value calculated for methylcyclohexane?
October 13, 2011

english
what is a conjunction give example
October 12, 2011

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | Next>>

Search
Members