Tuesday
July 29, 2014

Posts by Tony


Total # Posts: 800

algebra
Of the two fractions 15/21 and 19/17 which is smaller? I think its 19/17 but need someone to double check please.

algebra
Convert the fraction 8/17 to a decimal. Can you show me how to do this?

geometry
Find the surface area and the volume of a sphere whose radius equals 4?

math
80

math
If you toss a coin three times in a row, what is the probability of getting a head, a tail, and then a head? 1/2*1/2*1/2= 0.125 ????

A level, Mechanics
An object of mass 100 kg is suspended by two identical cables. The tension in cable one is (400i + 300j)N, where i and j are horizontal and vertical unit vectors respectively. The tension in cable two is (pi + qj)N. If the object remain at rest, find p and q

math
A cable weighing 2 lb/ft is 16 ft long. If a 20-lb weight is attached to the end, find the work done in winding up the chain.

grade 6 math
how many rectangles can have the perimiter of 46m

economics
what is the answer to this????

College Physics 2056
Figured it out. E/SA=t 1000/[(2.38e14*B^2)*(Area)]= t

College Physics 2056
An electromagnetic wave strikes a 3.00-cm2 section of wall perpendicularly. The rms value of the wave's magnetic field is determined to be 6.00 10-4 T. How long does it take for the wave to deliver 1000 J of energy to the wall?

6th G Math
Find the area of one rectangle flag. 7in x 8in = ? Divide the area by 2 (because half of the flag is white, the other half is red) That is the area of one white triangle. You need 100 flags so multiply that number by 100. _____ in^2 of fabric

health
all of the following conditions were responsible for the majority of premature deaths in the early 1900's except

english
the snow is so deep mean?

english
what is the personification of this sentence The wind whispered through the dark and gloomy forest.

AQA Mechanics (M1), Statics and forces, please hel
A particle of weight W is attached by a light inextensible string of length a to a point A on a verticle wall. The particle is supported in equilbrium by a light rigid strut of length b attached to a point B on the wall at a distance a vertically below A. Show that the tension...

grammar
Apa MLA Supposed Their

chemistry
72.97

M1, Mechanics
A particle of mass 4kg is suspended from a point A on a vertical wall by means of a light inextensible string of length 130cm.A horizontal force P, is applied to the particle so that it is held in equilibrium a distance of 50cm from the wall. Find the value of P and the tensio...

HVAC
Why must all valves be open when an evacuation is performed?

Chemistry
How many electrons are in oxide and in oxygen

math
Find the coordinates of the x-intercept. 2x + y = -6

American Government
its 3

math
A pie chart of total number of students in a school has a sector 35degree representing 14students.how many students are there in the school altogether?

chemistry
Thank you I been trying to really get the first three I think I figured out the rest through your help thanks.

chemistry
Calculate the following: (a) mass of water in the hydrate sample (g): (b) number of moles of water in the sample: (c) mass of pure salt in the sample (g): (d) number of moles of salt in the sample: (e) molar ratio of water to salt in the sample: If the mass of the empty crucib...

algebra
A taxi driver charges a flat rate of $3.00 and $0.08 per mile traveled

math at
Mary has read 1/3 of a 240-page book. How many pages does she still have to read to finish the book? What percent of the book does she still have to read?

budgeting
Throw out the high and low values and average the remaining factors

Medical Terminology
Why is it so important to know terms that are associated with all of thedifferent body systems even if you were to only work with onesystem?

vocabulary
need root or base word

vocabulary
levity

vocabulary
when would you not use it

vocabulary
it doesn't have the root word

vocabulary
answer each question based on your understanding of the boldfaced vocabulary what are some situation when levity is out of place

vocab
whats the root or base word of rebellious,belligerent, doctrine, document, levity, levitate, initiative, itinerary, impulsive, compel

Chemistry
Please help me with question #2: How do you determine if there is a linear relationship between NaCO3 used and CO2 produced?Discuss your results in terms of moles. Thank you!! Question #1 : 1. Record the amount of CO2 produced versus the amount of Na2CO3 used. Answer : 1.The a...

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware she...

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware shel...

4thGrade Math
8.8 inches

Chemistry
Please help me with the questions at the end of this chemistry lab.Thank you for any help you can provide. 1. This experiment requires you to do 7 trials with varying amounts of Na©üCO©ý. 2. Take a clean 50 mL beaker from the Glassware shelf and place it ...

geometry
find the coordinates of the circumcenter of tringleABC A(3,-1),B(-2,-1),C(3,-8)

Physics
You are driving your car and the traffic light ahead turns red. you apply the breaks for 3.0 s, and the velocity of the care decrease for +4.5 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?

Science
You are driving you car and the traffic light ahead turns red. you apply the breaks for 3.0s, and the velocity of the care decrease for +45 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?

Science
What is the magnitude of the average acceleration of a skier who, starting from rest, reachers a speed of 8.0m/s when going down a slope for 5.0 s? how far does the skier travel in this time?

Anthropology
Whsy

math
Ken paid $8.50 for tickets an adult paid $2.00 more than a child how much does the adult pay

Math
C?

Math
I dont know how to simplify

Math
A box contains 1 white bow, 2 yellow bows, 3 red bows, and 6 green bows. The bows are all the same size and shape. If Patricia reaches in the box and pulls out a bow without looking, what is the probability that it will be yellow? A.1/12 B.2/10 C.1/6 D.1/4

math
Thanks that is what i did but i wasn't sure if i had to include the extra 1/2 sheet in my answer.

math
thank you. would you know how to draw that out in pictures. I have to use a picture. thank you

math
in art class there are 5 sheets of drawing paper for 9 people. how much paper will each person get?

math
Joyce took out a loan for $21,900 at 12 percent on March 18, 2007, which will be due on January 9, 2008. Using ordinary interest, Joyce will pay back on Jan. 9 a total amount:

business math
Matty Kaminsky owns a new Volvo. His June monthly interest was $400. The rate is 8 ½ percent. Matty's principal balance at the beginning of June is: (Use 360 days)

ci
A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in the general population. A random sample of 90 students at a private high school is tested and and a mean SAT score of 1030 is obtained. The average sc...

Statistics
A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in the general population. A random sample of 90 students at a private high school is tested and has a mean SAT score of 1050. The average score for publ...

Math
Use elements in the order given to determine rows and columns of the matrix. R on {1,2,3,4} where aRb means |a-b| <1. R on {1,2,3,4,6,12} where aRb means a|b.

math
50 is what percent of 900 (Round to nearest tenth of a percent

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA

accounting
prepare the appropriate adjusting entry for the year Rent of $24,000 for a full year was paid on August 31,2011

math
(0,2) is correct it is (2,12) not (2,8)

Physics
A woman drops a basketball, how far does it fall in one second? use formulas

college math
1 __ 5 and 1 __ 20

college math
Aging in the United States In 2050, about 1 over 5 of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in 2050. (Source: U.S. Census Bureau.)

math
i posted this yesterday and never recieved a answer i do really neeed this help need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estima...

math
need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in ...

math
need step by step on how we get the answer Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal.(Source: U.S. Census Bureau.)

math
question is need for you to show me how you got the answer step by step in order to learn on how to do the other ones.

math
need help in solving Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal. (Source: U.S. Census Bureau.)

chemistry
calculate the density of oxygen,O/2 under each of the followig conditions-stp,1.00 atm and 35.0 celsius?

chemistry
why is the energy difference for t-butylcyclohexane significantly greater than the corresponding value calculated for methylcyclohexane?

english
what is a conjunction give example

Physics
When finding how high the platform is the horizontal velocity isn't important. S= 1/2at^2 where S is the displacement and a is the acceleration due to gravity (9.8) so S=(1/2) (9.8) 1.7^2 S=4.9*1.7^2 S=14.161 meters When finding how far from the base Janet lands use the fo...

Finance
assume that $10 million dollars of debt replaces 625,000 shares of common stock. The intrest in the new stock is 11.25 percent what will projected earnings per share be based on the anticipated sales increase of $500,000

law
Legal Assistants typically work in a law office under the supervision of a/an: (Points: 5) attorney. freelancer. judge. legal secretary. Is it "Attorney"

law
Profits for a firm increase by lowering the firm’s __________ costs. (Points: 5) social judicial operating damage Is it "operating"

law
Most management in large law firms is handled by: (Points: 5) judges. legal administrators. systems. contract employees Is it "legal administrators"

math
A garbage can is in the shape of a rectangular prism. The area of the base of the garbage can is 480 square inches. The height of the garbage can is 30 inches. (Part A) how many cubic inches of space are inside this garbage can? (Part B) Explain how you know your answer is cor...

hw help ASAP
8.00 (in^3) = 131.096512 ml

MATH help
The question is really confusing now.. The equation for the dimensions are different and we calculate the x in a different way? From what I see you are saying : the equation of the box is (x)(x+3)=180 when this is put into a Quadratic equation this gives us -15, 12 12 is consi...

brain teaser
You are standing outside a closed door. On the other side of the door is a room that has three light bulbs in it. The room is completely sealed off from the outside. It has no windows and nothing can get in or out except through the door. On the outside of the room there are t...

brain teaser
U2 has a concert that starts in 17 minutes and they must all cross a bridge to get there. All four men begin on the same side of the bridge. You must help them across to the other side. It is night. There is one flashlight. A maximum of two people can cross at one time. Any pa...

College Basic Math
11. Write as a decimal. 9% a.0.9 b. 0.09 c. 0.009 d. 9 i think its B

College Basic Math
Round to nearest hundred? 483.9 a. 400 b. 484 c. 480 d. 500 I think its A

real estate law
1. D 2. C

real estate law
1. A real estate contract will contain the: (Points: 5) a. credit report of the buyers. b. mortgage information of the sellers. c. hopes and wishes of the buyers. d. terms of the deal. I think is A 2. Most lenders typically require that a borrower purchase __________ insurance...

Real Estate Law
Ownership rights that are associated with ownership of property include: (Points: 5) no rights at all. the right to lease it. the right to burn it down. the right to destroy it if someone else wants it. I think its (b)

Real Estate Law
Rights that are associated with ownership of property and the effect that these rights may have on property are known as: (Points: 5) interest in property. ownership rights. property. title. I think its (C)

Organic Chemistry
Draw and describe the three overall redox reactions than occur in the conversion of 2,6-dimethylnitrobenzene to 2,6-dimethylaniline using stannous chloride. (Not the mechanisms). What are the key structures in these reactions, and what are their oxidation states? What are the ...

algebra
solve. 0.7x+4<1.1x-7 -

CALCULUS HELP !
f(x)=(-3x^3-x^2-9x-8)/(6x^2+4x+3. Find the equation of the non-vertical asymptote. y= Does f(x) intersect its non-vertical asymptote ? What is the smallest value of x at which f(c) intersects its non-vertical asymptote ? please show all the work. I did this and got the wrong a...

CAL
THe circumference of a sphere was measured to be 74.000 cm with a possible error of 0.50000 cm. Use the linear appoximation to estimate the maximum error in the calculated surface area. and estimate the relative error in the calculated surface area.

Math
If 3000 dollars is invested in a bank account at an interest rate of 6 per cent per year, find the amount in the bank after 12 years if interest is compounded annually Find the amount in the bank after 12 years if interest is compounded quaterly Find the amount in the bank aft...

Cal
i meant x=0

Cal
Find the volume of the solid formed by rotating the region enclosed by y=(e^(2x))+4,y=0,x-0,x=0.4. I tried doing this but got really confused. Really appreciate it if you guys help.Tnks

Wealth and International Trad
Globalization and global trade have led to increased competition in world markets and increased allocation of scarce resources. Is it accurate to say that this is contributing to increased consumer surplus and reductions in inflationary pressures? If yes, how (explain using ec...

chem
Determine the density of methane (CH4) in g/L at 21.9oC and 0.9 atm

physics
Horizontally: Vavg = x/t so t x/Vavg t = 18.4 m/5.5m/s = 3.345 sec Vertically: (parallel to the wall) Assuming initial velocity in this direction is zero Vfinal = Vinitial + at so: Vfinal = 0 + (1.8 m/s^2)(3.345 sec) = 6.0 m/s Using pythagorean theorem to find the final veloci...

physics
Vavg = X/T so T = X/Vavg Car: 140 miles/40 mph = 3.5 hours Coach: 140 miles/30 mph = 4.66 hours So the coach arrive 1.66 hours after the car. .66 *60 = 40 minutes so: The coach arrives at 1:40 pm

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | Next>>

Search
Members