Thursday
August 21, 2014

Posts by Tony


Total # Posts: 794

algebra
Of the two fractions 15/21 and 19/17 which is smaller? I think its 19/17 but need someone to double check please.
May 30, 2012

algebra
Convert the fraction 8/17 to a decimal. Can you show me how to do this?
May 30, 2012

geometry
Find the surface area and the volume of a sphere whose radius equals 4?
May 15, 2012

math
80
May 15, 2012

math
If you toss a coin three times in a row, what is the probability of getting a head, a tail, and then a head? 1/2*1/2*1/2= 0.125 ????
April 26, 2012

A level, Mechanics
An object of mass 100 kg is suspended by two identical cables. The tension in cable one is (400i + 300j)N, where i and j are horizontal and vertical unit vectors respectively. The tension in cable two is (pi + qj)N. If the object remain at rest, find p and q
April 19, 2012

math
A cable weighing 2 lb/ft is 16 ft long. If a 20-lb weight is attached to the end, find the work done in winding up the chain.
April 18, 2012

grade 6 math
how many rectangles can have the perimiter of 46m
April 16, 2012

economics
what is the answer to this????
April 16, 2012

College Physics 2056
Figured it out. E/SA=t 1000/[(2.38e14*B^2)*(Area)]= t
April 8, 2012

College Physics 2056
An electromagnetic wave strikes a 3.00-cm2 section of wall perpendicularly. The rms value of the wave's magnetic field is determined to be 6.00 10-4 T. How long does it take for the wave to deliver 1000 J of energy to the wall?
April 8, 2012

6th G Math
Find the area of one rectangle flag. 7in x 8in = ? Divide the area by 2 (because half of the flag is white, the other half is red) That is the area of one white triangle. You need 100 flags so multiply that number by 100. _____ in^2 of fabric
April 7, 2012

health
all of the following conditions were responsible for the majority of premature deaths in the early 1900's except
April 7, 2012

english
the snow is so deep mean?
April 7, 2012

english
what is the personification of this sentence The wind whispered through the dark and gloomy forest.
April 6, 2012

AQA Mechanics (M1), Statics and forces, please hel
A particle of weight W is attached by a light inextensible string of length a to a point A on a verticle wall. The particle is supported in equilbrium by a light rigid strut of length b attached to a point B on the wall at a distance a vertically below A. Show that the tension...
April 1, 2012

grammar
Apa MLA Supposed Their
March 30, 2012

chemistry
72.97
March 26, 2012

M1, Mechanics
A particle of mass 4kg is suspended from a point A on a vertical wall by means of a light inextensible string of length 130cm.A horizontal force P, is applied to the particle so that it is held in equilibrium a distance of 50cm from the wall. Find the value of P and the ...
March 19, 2012

HVAC
Why must all valves be open when an evacuation is performed?
March 18, 2012

Chemistry
How many electrons are in oxide and in oxygen
March 14, 2012

math
Find the coordinates of the x-intercept. 2x + y = -6
March 11, 2012

American Government
its 3
March 5, 2012

math
A pie chart of total number of students in a school has a sector 35degree representing 14students.how many students are there in the school altogether?
February 24, 2012

chemistry
Thank you I been trying to really get the first three I think I figured out the rest through your help thanks.
February 11, 2012

chemistry
Calculate the following: (a) mass of water in the hydrate sample (g): (b) number of moles of water in the sample: (c) mass of pure salt in the sample (g): (d) number of moles of salt in the sample: (e) molar ratio of water to salt in the sample: If the mass of the empty ...
February 11, 2012

algebra
A taxi driver charges a flat rate of $3.00 and $0.08 per mile traveled
February 11, 2012

math at
Mary has read 1/3 of a 240-page book. How many pages does she still have to read to finish the book? What percent of the book does she still have to read?
February 9, 2012

budgeting
Throw out the high and low values and average the remaining factors
February 8, 2012

Medical Terminology
Why is it so important to know terms that are associated with all of thedifferent body systems even if you were to only work with onesystem?
February 6, 2012

vocabulary
need root or base word
February 5, 2012

vocabulary
levity
February 5, 2012

vocabulary
when would you not use it
February 5, 2012

vocabulary
it doesn't have the root word
February 5, 2012

vocabulary
answer each question based on your understanding of the boldfaced vocabulary what are some situation when levity is out of place
February 5, 2012

vocab
whats the root or base word of rebellious,belligerent, doctrine, document, levity, levitate, initiative, itinerary, impulsive, compel
February 5, 2012

Chemistry
Please help me with question #2: How do you determine if there is a linear relationship between NaCO3 used and CO2 produced?Discuss your results in terms of moles. Thank you!! Question #1 : 1. Record the amount of CO2 produced versus the amount of Na2CO3 used. Answer : 1.The ...
January 20, 2012

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

Chemistry
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade chemistry class. 1. This experiment requires you to do 7 trials with varying amounts of Na2CO2. 2. Take a clean 50 mL beaker from the Glassware ...
January 19, 2012

4thGrade Math
8.8 inches
January 19, 2012

Chemistry
Please help me with the questions at the end of this chemistry lab.Thank you for any help you can provide. 1. This experiment requires you to do 7 trials with varying amounts of Na©üCO©ý. 2. Take a clean 50 mL beaker from the Glassware shelf and place it ...
January 19, 2012

geometry
find the coordinates of the circumcenter of tringleABC A(3,-1),B(-2,-1),C(3,-8)
January 13, 2012

Physics
You are driving your car and the traffic light ahead turns red. you apply the breaks for 3.0 s, and the velocity of the care decrease for +4.5 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 11, 2012

Science
You are driving you car and the traffic light ahead turns red. you apply the breaks for 3.0s, and the velocity of the care decrease for +45 m/s. if the cars deceleration has a magnitude of 2.7 m/s^2, what is the cars displacement during this time?
January 10, 2012

Science
What is the magnitude of the average acceleration of a skier who, starting from rest, reachers a speed of 8.0m/s when going down a slope for 5.0 s? how far does the skier travel in this time?
January 10, 2012

Anthropology
Whsy
December 15, 2011

math
Ken paid $8.50 for tickets an adult paid $2.00 more than a child how much does the adult pay
December 1, 2011

Math
C?
November 29, 2011

Math
I dont know how to simplify
November 29, 2011

Math
A box contains 1 white bow, 2 yellow bows, 3 red bows, and 6 green bows. The bows are all the same size and shape. If Patricia reaches in the box and pulls out a bow without looking, what is the probability that it will be yellow? A.1/12 B.2/10 C.1/6 D.1/4
November 29, 2011

math
Thanks that is what i did but i wasn't sure if i had to include the extra 1/2 sheet in my answer.
November 22, 2011

math
thank you. would you know how to draw that out in pictures. I have to use a picture. thank you
November 22, 2011

math
in art class there are 5 sheets of drawing paper for 9 people. how much paper will each person get?
November 22, 2011

math
Joyce took out a loan for $21,900 at 12 percent on March 18, 2007, which will be due on January 9, 2008. Using ordinary interest, Joyce will pay back on Jan. 9 a total amount:
November 20, 2011

business math
Matty Kaminsky owns a new Volvo. His June monthly interest was $400. The rate is 8 ½ percent. Matty's principal balance at the beginning of June is: (Use 360 days)
November 20, 2011

ci
A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in the general population. A random sample of 90 students at a private high school is tested and and a mean SAT score of 1030 is obtained. The average ...
November 19, 2011

Statistics
A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in the general population. A random sample of 90 students at a private high school is tested and has a mean SAT score of 1050. The average score for ...
November 19, 2011

Math
Use elements in the order given to determine rows and columns of the matrix. R on {1,2,3,4} where aRb means |a-b| <1. R on {1,2,3,4,6,12} where aRb means a|b.
November 18, 2011

math
50 is what percent of 900 (Round to nearest tenth of a percent
November 11, 2011

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011

accounting
prepare the appropriate adjusting entry for the year Rent of $24,000 for a full year was paid on August 31,2011
October 30, 2011

math
(0,2) is correct it is (2,12) not (2,8)
October 28, 2011

Physics
A woman drops a basketball, how far does it fall in one second? use formulas
October 28, 2011

college math
1 __ 5 and 1 __ 20
October 26, 2011

college math
Aging in the United States In 2050, about 1 over 5 of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in 2050. (Source: U.S. Census Bureau.)
October 26, 2011

math
i posted this yesterday and never recieved a answer i do really neeed this help need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. ...
October 26, 2011

math
need step by step on how you get the answer Aging in the United States In 2050, about of the population will be aged 65 or over and about 1 over 20 of the population will be aged 85 or over. Estimate the fraction of the population that will be between the ages of 65 and 85 in ...
October 25, 2011

math
need step by step on how we get the answer Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal.(Source: U.S. Census Bureau.)
October 25, 2011

math
question is need for you to show me how you got the answer step by step in order to learn on how to do the other ones.
October 25, 2011

math
need help in solving Uninsured Americans In 2005, the fraction of Americans who did not have health insurance coverage was . 39 over 250 Write this fraction as a decimal. (Source: U.S. Census Bureau.)
October 25, 2011

chemistry
calculate the density of oxygen,O/2 under each of the followig conditions-stp,1.00 atm and 35.0 celsius?
October 19, 2011

chemistry
why is the energy difference for t-butylcyclohexane significantly greater than the corresponding value calculated for methylcyclohexane?
October 13, 2011

english
what is a conjunction give example
October 12, 2011

Physics
When finding how high the platform is the horizontal velocity isn't important. S= 1/2at^2 where S is the displacement and a is the acceleration due to gravity (9.8) so S=(1/2) (9.8) 1.7^2 S=4.9*1.7^2 S=14.161 meters When finding how far from the base Janet lands use the ...
October 12, 2011

Finance
assume that $10 million dollars of debt replaces 625,000 shares of common stock. The intrest in the new stock is 11.25 percent what will projected earnings per share be based on the anticipated sales increase of $500,000
October 11, 2011

law
Legal Assistants typically work in a law office under the supervision of a/an: (Points: 5) attorney. freelancer. judge. legal secretary. Is it "Attorney"
October 6, 2011

law
Profits for a firm increase by lowering the firm’s __________ costs. (Points: 5) social judicial operating damage Is it "operating"
October 6, 2011

law
Most management in large law firms is handled by: (Points: 5) judges. legal administrators. systems. contract employees Is it "legal administrators"
October 6, 2011

math
A garbage can is in the shape of a rectangular prism. The area of the base of the garbage can is 480 square inches. The height of the garbage can is 30 inches. (Part A) how many cubic inches of space are inside this garbage can? (Part B) Explain how you know your answer is ...
September 25, 2011

hw help ASAP
8.00 (in^3) = 131.096512 ml
September 19, 2011

MATH help
The question is really confusing now.. The equation for the dimensions are different and we calculate the x in a different way? From what I see you are saying : the equation of the box is (x)(x+3)=180 when this is put into a Quadratic equation this gives us -15, 12 12 is ...
September 18, 2011

brain teaser
You are standing outside a closed door. On the other side of the door is a room that has three light bulbs in it. The room is completely sealed off from the outside. It has no windows and nothing can get in or out except through the door. On the outside of the room there are ...
September 14, 2011

brain teaser
U2 has a concert that starts in 17 minutes and they must all cross a bridge to get there. All four men begin on the same side of the bridge. You must help them across to the other side. It is night. There is one flashlight. A maximum of two people can cross at one time. Any ...
September 14, 2011

College Basic Math
11. Write as a decimal. 9% a.0.9 b. 0.09 c. 0.009 d. 9 i think its B
September 2, 2011

College Basic Math
Round to nearest hundred? 483.9 a. 400 b. 484 c. 480 d. 500 I think its A
September 2, 2011

real estate law
1. D 2. C
August 6, 2011

real estate law
1. A real estate contract will contain the: (Points: 5) a. credit report of the buyers. b. mortgage information of the sellers. c. hopes and wishes of the buyers. d. terms of the deal. I think is A 2. Most lenders typically require that a borrower purchase __________ insurance...
August 6, 2011

Real Estate Law
Ownership rights that are associated with ownership of property include: (Points: 5) no rights at all. the right to lease it. the right to burn it down. the right to destroy it if someone else wants it. I think its (b)
July 28, 2011

Real Estate Law
Rights that are associated with ownership of property and the effect that these rights may have on property are known as: (Points: 5) interest in property. ownership rights. property. title. I think its (C)
July 28, 2011

Organic Chemistry
Draw and describe the three overall redox reactions than occur in the conversion of 2,6-dimethylnitrobenzene to 2,6-dimethylaniline using stannous chloride. (Not the mechanisms). What are the key structures in these reactions, and what are their oxidation states? What are the ...
July 25, 2011

algebra
solve. 0.7x+4<1.1x-7 -
July 25, 2011

CALCULUS HELP !
f(x)=(-3x^3-x^2-9x-8)/(6x^2+4x+3. Find the equation of the non-vertical asymptote. y= Does f(x) intersect its non-vertical asymptote ? What is the smallest value of x at which f(c) intersects its non-vertical asymptote ? please show all the work. I did this and got the wrong ...
July 21, 2011

CAL
THe circumference of a sphere was measured to be 74.000 cm with a possible error of 0.50000 cm. Use the linear appoximation to estimate the maximum error in the calculated surface area. and estimate the relative error in the calculated surface area.
July 19, 2011

Math
If 3000 dollars is invested in a bank account at an interest rate of 6 per cent per year, find the amount in the bank after 12 years if interest is compounded annually Find the amount in the bank after 12 years if interest is compounded quaterly Find the amount in the bank ...
July 13, 2011

Cal
i meant x=0
July 13, 2011

Cal
Find the volume of the solid formed by rotating the region enclosed by y=(e^(2x))+4,y=0,x-0,x=0.4. I tried doing this but got really confused. Really appreciate it if you guys help.Tnks
July 13, 2011

Wealth and International Trad
Globalization and global trade have led to increased competition in world markets and increased allocation of scarce resources. Is it accurate to say that this is contributing to increased consumer surplus and reductions in inflationary pressures? If yes, how (explain using ...
June 30, 2011

chem
Determine the density of methane (CH4) in g/L at 21.9oC and 0.9 atm
June 29, 2011

physics
Horizontally: Vavg = x/t so t x/Vavg t = 18.4 m/5.5m/s = 3.345 sec Vertically: (parallel to the wall) Assuming initial velocity in this direction is zero Vfinal = Vinitial + at so: Vfinal = 0 + (1.8 m/s^2)(3.345 sec) = 6.0 m/s Using pythagorean theorem to find the final ...
June 23, 2011

physics
Vavg = X/T so T = X/Vavg Car: 140 miles/40 mph = 3.5 hours Coach: 140 miles/30 mph = 4.66 hours So the coach arrive 1.66 hours after the car. .66 *60 = 40 minutes so: The coach arrives at 1:40 pm
June 23, 2011

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | Next>>

Search
Members