August 27, 2016


Total # Posts: 1,170

If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?
August 13, 2016

If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?
August 13, 2016

How many 3 5\8 board can be cut from a 10 ft board?
August 6, 2016

pre algebra
The difference between two numbers is 44. Five times the smaller is equal to 8 more than the larger. What are the numbers
July 30, 2016

laura spent 20 percent of her money on a dress. she spent 2/5 of the remainder on a book. she had $72 left. how much money did she have at first?
July 13, 2016

X/5 -g=a for x
June 21, 2016

Flying against the wind, an airplane travels 5600 km in 8 hours. Flying with the wind, the same plane travels 9900 km in 9 hours.
May 26, 2016

Global Communicaiton Studies
Which socio-cultural variable is the most important and why? Looking forward to your insights. Thank you!
May 20, 2016

Math- any help would be greatly appreciated
In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.
May 19, 2016

In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.
May 19, 2016

A drug is administered every 6 hours. The kidney eliminates 55% of the drug over that period. The initial dose is 210 mg. Repeated dosage is 70 mg. What is the "differnece equation"?
May 17, 2016

So aria what is the answer??? Was it successful and how did you determine it?
May 12, 2016

power supply in Nigeria is assumed to be normally distributed with daily mean at 68 minutes and variance 49 minutes .what is the probability of having power supply for (1) less than 45 minutes? (2) at least 1 hour? (3) between 75 minutes and 90 minutes?
May 11, 2016

using determinant method find the area of the quadrilateral ABCD given the coordinates A(3,3) B(-2,5) c(-1,2) D(1,1)
May 11, 2016

my son informed me that a comic book I purchased for 10 cents in 1948 is worth $85. today what has been the average annual compound rate of return on that valuable asset
April 26, 2016

In how many ways can 5 of 14 different sized and different colored beads be put on a string to form a necklace. would the answer be 14!/!9 ?
April 16, 2016

Energy of satellite PHYSICS
But how do I get it to Joules? thanks
April 10, 2016

Energy of satellite PHYSICS
An m = 43 kg mass instrument package is put into orbit at an altitude above the Earth of A = 23000 km. What is the kinetic energy of this satellite in Joules?
April 10, 2016

I'm sorry but I had to post this question again as I left out the question. In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green ...
April 5, 2016

In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green melons and a plant that produced yellow melons. When the student observed the next ...
April 2, 2016

The sum of the digits on a digital clock is 15. The number of minutes is 5 times the number of hours. Wheat time is it?
April 1, 2016

Negative square root of 22*
March 14, 2016

If tan theta equal - square root of 22 divided by 11 and pie/2 is less than theta and theta is less than pies, what is the cos of theta in simplified rationalized form
March 14, 2016

A cafe used 640 ounces of water to make tea how many quarts of water did the cafe USED
March 1, 2016

Infinite math
A company finds that producing 12 items costs $31, while producing 7 items costs $25. What's the company's marginal cost?
February 29, 2016

Home Depot wants to buy a new line of fertilizers. Manufacturer A offers a 19/14 chain discount. Manufacturer B offers a 24/12 chain discount. Both manufacturers have the same list price.
February 3, 2016

business math
Front Range Cabinet Distributors in Colorado Springs, Colorado, sells to its contractors with a 32% markup on cost. If the selling price for cabinets is $9,357, what is the cost to contractors based on cost?
February 1, 2016

AP Chemistry
Which of the following is true about lanthanides? A. they are all radioactive B. they are highly electropositive C. they are very common elements D. they have low melting and boiling points
January 29, 2016

January 25, 2016

In 2013, the price of a business math text rose to $120. This is 10% more than the 2012 price. What was the old selling price?
January 15, 2016

Satelite Corporation projects a year-end net income of $64,497. The net income represents 31% of its projected annual sales. What are Satelite's projected annual sales?
January 14, 2016

The factory wants you to build a box that will hold twice as many cubes. What are the dimensions f a box that contains two times as many cubes as a box that is 2 by 3 by 4
January 13, 2016

a major airline laid of 4000 pilots and flight attendants. if this was 12.5% reduction in the workforce, what was the size of the workforce after layoffs?
January 12, 2016

what is the advantage of using the indirect method over the direct method for calculating the enthalpy change of 2KHCO3 - K2CO3 + CO2 + H20
January 3, 2016

Over 350 students took a college calculus final exam. the scores of the students follow a normal distribution. using the information given below, determine the mean and the standard deviation for the students'scores. Give your answers to the nearest tenth of a percent. 1. ...
December 27, 2015

Ammonium carbonate decomposes upon heating according to the balanced equation: (NH4)2CO3(s) -> 2NH3(g)+CO2(g)+H2O(g) Calculate the total volume of gas produced at 27.0 degrees C and 2.03 atm from the reaction of 1.4kg of (NH4)2CO3. What is the pressure of each of the gases ...
December 3, 2015

I need to predict a certain number of pens in the bag how do i do this You have a bag of 100 pens you choose 7 green pens and 13 purple pens predict the number of purple pens in the bag.
November 23, 2015

AP Lang
If they give you a ruled paper, write the other way. What kindof figurative language is being used and what type of sentence is this
November 17, 2015

If there are 10 more boys than girls,how many are girls and how many are boys? (I think out of 28)
November 7, 2015

First week sells 6 chairs for $80 each. Next week, if chair is not sold, it will sell for 0.85 times previous week's price. Store needs to sell 6 chairs for total of $270 to make a profit. what is the last week in which all 6 chairs could be sold so that the store makes a ...
November 2, 2015

Two particles approach each other with equal and opposite speed v. The mass of one particle is m, and the mass of the other particle is nm, where n is just a unitless number. Snapshots of the system before, during, and after the elastic collision are shown above. After the ...
November 1, 2015

Suppose the horizontal sweep of an oscilloscope takes 80ms how many cycles of a 100 Hz wave will be shown?
October 2, 2015

edit: which one of these careers ______ to a six-figure salary? c <--
September 24, 2015

fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c <--
September 24, 2015

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
September 24, 2015

Need HELP really bad test tommorrow
x is the values you plug into like 0,1,2,3 but I'm confused how to solve when plugging in because of the greatest integer function value
September 21, 2015

Need HELP reall bad test tommorrow
how to make a xy table for the following greatest integer equation. f(x)=2[x], g(x)=[2x], f(x)=-[[x]], and g(x)=[[-x]] thank you for the help
September 21, 2015

September 21, 2015

You have to draw three circles that go from up to down, then draw circles across so it goes left to right until you have nine in each row. Or you can have three circles going left to right then draw circles from up the down until you have nine in each column.
September 17, 2015

*(and/or width) of a square...
September 17, 2015

I think that since you need to know the length (and width) of a square (and pretty much any other shape) to find out its area, that's how they are related. Or you could always work backwards, knowing the area but not the side lengths. Hope this helps! Sorry if it didn'...
September 17, 2015

$9118 + $609 = $9727, then $9727 - $1011 = $8716, then $8716 + $705 = $9421. Finally, you have to do $9421 - $9118, which equals $303. So, she had $303 more by the end of May from how much she had by the start of March. Hope this helped :)
September 17, 2015

September 17, 2015

Suppose the firm (has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) had 85,000 shares of common stock outstanding. What is the earnings per share, or EPS, figure? What is the dividends per ...
September 2, 2015

Suppose the firm in paid out (sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) $73,000 in cash dividends. What is the addition to retained earnings?
September 2, 2015

Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?
September 2, 2015

your test scores in one class are 80 and 88. what possible scores can you earn on your next test to have a test average between 84 and 89, inclusive?
September 1, 2015

Algebra 2
a car travels for 2 hours at r mph and then decreases its speed by 5mph for the next 3 hours. What is total time traveled?
August 31, 2015

Samuel Johnson's Letter to Lord Chesterfield ? Help? Where in the letter does the tone seem ironic? And also where does the tone shift? Please Help
August 27, 2015

How do I solve these equations? I need to create an equation given the characteristics? I have to be able to graph a parabola but first I need help solving this. 1.Focus (1.5,1); opens right; directrix x=0.5 2.Focus (1,4);opens down; contains (-3,1)
August 19, 2015

1.If para- means beyond, then a paradox is something that is... 2.Examples of dogma 3.Using literal translations without the dictionary. -The prefix ortho- means "straight" or "correct" -The prefix hetero means "different" -The prefix homo means &...
August 18, 2015

Explain how the graph of f(x) = ln x can be used to obtain the graph of g(x) = e^(x-2).
July 20, 2015

Explain why an even function does not have an inverse that is a function.
July 20, 2015

Math (Finite)
In how many ways can a committee of 7 people be chosen from 15 married couples if 2 couples must be on the committee?
July 19, 2015

Math (Finite)
A test for a certain drug produces a false negative 5% of the time and a false positive 8% of the time. Suppose 12% of the employees at a certain company use the drug. If an employee at the company tests positive, what is the probability that he or she does not use the drug?
July 9, 2015

Math (Finite)
An election between two candidates is held in two districts. The first district, which has 60% of the voters, votes 40% for candidate 1 and 60% for candidate 2. The second district, with 40% of the voters, votes 60% for candidate 1 and 40% for candidate 2. Who wins?
July 9, 2015

Math (Finite)
Find the probability that among five persons, at least two were born on the same weekday.
July 9, 2015

Math (Finite)
A calling card offers two methods of paying for a phone call. Method A charges $0.02 per minute but has a $0.6 connection fee. Method B charges $0.045 per minute but has no connection fee. Write the equations that show the total cost, y, of a call of x minutes for methods A ...
July 7, 2015

Math (Finite)
5. Let A = 1 4 2 3 and B = 3 -2 4 6 calculate the entry in the second row, second column in AB
July 6, 2015

Finite Math
11. As part of a weight reduction program, a man designs a monthly exercise program consisting of bicycling, jogging, and swimming. He would like to exercise at most 38 hours, devote at most 3 hours to swimming, and jog for no more than the total number of hours bicycling and ...
June 27, 2015

Finite Math
15 An appliance store sells two brands of televisions. Each Daybrite set sells for $425, and each Noglare set sells for $700. The store’s warehouse capacity for television sets is $400, and new sets are delivered only each month. Records show that customers will buy at ...
June 27, 2015

Corporate Finance
Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?
June 11, 2015

Math (Finite)
A town council has 11 members, 6 Democrats and 5 Republicans. If a 3‐person committee is selected at random, what is the probability that Republicans make up the majority?
June 11, 2015

Finite Math
A town council has 11 members, 6 Democrats and 5 Republicans. If a 3‐person committee is selected at random, what is the probability that Republicans make up the majority?
June 11, 2015

Math (Finite)
If a 3]person committee is selected at random, what is the probability that Republicans make up the majority?
June 11, 2015

Two cars drive from town A to town B at constant speeds. The blue car travels 25 miles per hour and the red car travels 60 miles per hour. The blue car leaves at 9:30 am and the red car leaves at noon. The distance between the two towns is 150 miles. Who will get there first? ...
May 29, 2015

Language Arts ASP
May you plz check this asp. 1. In You're a Good Man, Charlie Brown, why does Charlie Brown hesitate when answering Lucy's survey? (1 point) He wants to make sure that his answers are truthful. He does not fully understand the questions. He is afraid of her anger if he ...
May 28, 2015

Problem Solving
Thanks! I thought so but that just seemed so simple too me. I thought there was a catch to it.
May 27, 2015

Problem Solving
Liz has 2 books of 100 stamps with 6 left over. Chelsea has 3 books of 100 stamps with 8 left over. If they put all their stamps together, how many stamps will they have?
May 27, 2015

Language Arts 6th grade
Oh and this is ActII
May 26, 2015

Language Arts 6th grade
This is from Phantom Toll Both. I am having trouble finding similarity and differences can you give me a hint of start me off that would be great. At least two ways which Tock and Humbug are alike and different
May 26, 2015

What volume of 1.45 H2SO4 is required to neutralize .050L of .75M KOH?
May 24, 2015

Lanuage Arts
Question For the last question of Lesson 6: Third Read: The Phantom Tollbooth, Act I Connections Education Language Arts 6 B Unit 3: Adventures and Imagination I do not understand which book to use for the answer. Plz can you help me I have tempory zero :/
May 23, 2015

Describe the relationships among the major components that maintain Ca homeostasis. (Identify all the major factors which are involved in Ca homeostasis).
May 22, 2015

Can you give me help understanding this question? A skydiver prepares to jump out of a plane. Explain how gravity and air resistance will affect the motion of the skydiver before and after he or she opens the parachute.
May 21, 2015

Can you check my work PLzzzzz got alot of science for today.
May 11, 2015

Can you plz check asp 1. Suppose the total momentum of two masses before a collision is 100 kg m/s. What is the total momentum of the two masses after they collide? (1 point) 0 kg m/s 50 kg m/s 100 kg m/s 200 kg m/s 2. What is the momentum of a 20.0 kg scooter traveling at 5....
May 11, 2015

It is 1/7
May 11, 2015

Thanks alot Got my grade up too :)
May 11, 2015

Plz check it fast or just improve advice 9. Provide three statements that demonstrate the importance of units when describing motion. (3 points) Three statements that demonstrate the importance of units when describing motion are 1.unit i m/s indicate it is in SI unit 2.It ...
May 11, 2015

Science 6 th grade
Can you plz check this :0 True/False 1. Kilometers per hour describes the speed of an object. (1 point) true false * Multiple Choice 2. Which of the following reference points would allow you to observe the speed of a car that you are traveling in? (1 point) an airplane flying...
May 4, 2015

5.8 + 5.758
April 29, 2015

If i had a pizza, and i ate4/8 of the pizza and my sister ate 3/8 of the pizza, how much pizza did we eat
April 27, 2015

April 27, 2015

College algebra
8.8x10^3 hours in a year approximate how many in one year
April 23, 2015

SS 6th grade
Thank you some of them helped
April 21, 2015

SS 6th grade
Its about Roman empire and the fall of the Romans so basically all roman.
April 21, 2015

SS 6th grade
I have to study for a test which is called New Empires and New Faiths Unit Test. Do you have any websites that I could go to review or to practice?
April 21, 2015

A 42.5 g marble is fired vertically upward using a spring gun. The spring must be compressed 7.0 cm if the marble is to reach a target 27.0 m above the gun. What is the change in gravitational energy of the marble during its ascent?
April 9, 2015

If you have a bag of alphabet tiles that contains one tile for each letter of the alphabet. What is the probability that you will pull a vowel?
March 22, 2015

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. Next>>