Post a New Question

Posts by Jessica

Total # Posts: 3,341

calc
derivative of y=4^(6-x^2)

social studies. NEED HELP ASAP
thax

Science
?????? is right!! 4/4 100% thanks!! my mom was gonna take my phone if I didn't get a 100!!!

pre cal 11
thank you

pre cal 11
i am stuck at a question that is asking for the common difference, first term, and general term for the arithmetic sequence the question is t10=50 and t27=152 i found my d=6 and t1=(-4) so know my equation is: tn=(-4)+(n-1)6 i had asken my teacher to tell me what the general ...

pre cal 11
oh my god thank you i makes sense now

pre cal 11
hi so i am stuck at this question that is asking about arithmetic sequence . Five fence posts are equally spaced between two corner posts that are 42 meter apart. how far apart are the five fence posts. i know the answer is 7m but i don't know how plus i know the equation ...

linear
If possible, solve the following linear systems by Cramer's rule. 2x1 + 4x2 + 6x3 = 14 x1 + 2x3 = 0 2x1 + 3x2 − x3 = 30 i am having trouble with this one

Math
I have the same question for my homework. I am solving it now so i hope this helps you. First of all, George has already read 3 chapters of a 27 chapter book. On the second night, he read 8/27 of the book. In order to make 3/27, which came from the amount of chapters George ...

Algebra 1
There is a state soccer tournament with 128 teams competing for 1st place. Each week, half of the teams get eliminated. How many teams remain after 6 weeks? A. 16 B. 8 C. 4 D. 2

Health
yeah

Chemistry
A solution of 0.200M NaOH (14.0 mL) is mixed with 42.4 mL of 0.170M HNO3. Assuming the final volume is the sum of the initial volumes, what is the molarity of Na+ cation and NO3- anion? I do not know where to start to solved for the molarity of the ions. Please help !

science
A solution of 0.200M NaOH (14.0 mL) is mixed with 42.4 mL of 0.170M HNO3. Assuming the final volume is the sum of the initial volumes, what is the molarity of Na+ cation and NO3- anion? I do not know where to start to solved for the molarity of the ions. Please help !

math
Let y = integrate from 1-9x to 1 of (u^3)/(1+u^2) What is y'? I flipped the integral so it's 1 to 1-9x and had the derivative of -9 via chain rule so -9 and just plugged in 1-9x to the (u^3)/(1+u^2) so it's -9*((1-9x)^3)/(1+(1-9x)^2). It tells me what's wrong; ...

English
Can you help me annotate this prompt? I don't know really how to do it? In the following passage from the scarlet letter the narrator describes Hester Pyrnne in her isolation from Puritan community. In a well organized essay, analyze the language and rhetorical devices the...

english language
WRITE THE DEBATE

math-urgent
show that if A= A inverse, then det(A) = +/- 1 if A(transpose) = A(inverse), what is det(A)?

Finance
Given an interest rate of 6.25% compounded annually, how much would you accumulate if you started with $3,250 and then contributed $1,950 per year (at the end of each year) for 13 years? Is this correct? Calculate each FV and sum? PV1 = 3,250 i = 6.25% N = 13 FV = PV2 = 1,950 ...

Finance
Is this correct? Calculate the FV for each year and then sum? PV1 = 3,250 i = 6.25% N = 13 FV = PV2 = 1,950 i = 6.25% N = 12 FV = PV3 = 1,950 i = 6.25% N = 11 FV = PV4 = 1,950 i = 6.25% N = 10 FV = PV5 = 1,950 i = 6.25% N = 9 FV = PV6 = 1,950 i = 6.25% N = 8 FV = PV7 = 1,950 i...

Finance
Given an interest rate of 6.25% compounded annually, how much would you accumulate if you started with $3,250 and then contributed $1,950 per year (at the end of each year) for 13 years?

Algebra 2
f(x)=-x^2 - 3x Find the axis of symmetry, vertex, direction it opens, and write the equation in vertex form. If f(x) =x^2 + 2x g(x)= x-9 h(x) = 3x - 2 Find [f o g o h] (-2) Please explain how you got it I'm really confused right now.

Chemistry
Benzene has a vapor pressure of 183 mm Hg at 40 degrees Celsius. Taking it's heat of vaporization to be 30.8 kJ/mol, calculate it's vapor pressure at 25 degrees Celsius. The answer is 101 mm Hg, but I keep getting 4.613, and I can't figure out where 101 mm Hg comes...

English
This is from the scarlet letter

English
Chapter 23 and. 24 1. "Within the church, it had hardly been kept down; beneath the sky, it pealed upward to the zenith" is an example of a. Cumulative sentence B. Understatement C.oxymoron D balanced sentence E.paradox 2. What is the function of the words "...

Physics
A 447.5-N force accelerates a go-cart and its driver from 10.3 m/s to 16.7 m/s in 4.01 s. What is the mass of the go-cart plus driver?

English
Chapter 24 Scarlet letter Please tell me if these are correct or not The narrator characterizes Chillingworth by means of A. An allegory B.A Simile C.An allusion D.A metaphor E. An Anecdote I say D The narrator implies that the difference between hatred and love is primarily ...

math
Thom has a scale model of his car . The scale is 1:12 . If the actual car has 16-inch weeks,what size are the wheels on the scale model?

English
Can you check my answers to see if they are right and if not, help me on it? These questions begin with the paragraph starting with "Now was heard again the clangor of music ...." 1. In the first two paragraphs, the narrator conveys his mood of the market-place by ...

Science
3. a

physics
A physical pendulum is constructed of a 48 cm long piece of wooden dowel with a mass of 550 grams and a radius of 0.7 cm. Attached at one end of the pipe is a hoop with a radius of 6 cm and a mass of 1.2 kg as shown. The pendulum is released from the 12:00 position and allowed...

English-Scarlet Letter
1.How do the male characters treat, or talk about the female characters? 2.If the female characters had a power what kind will it be? Economical, Psychological, Social, Political , etc and Why? 3. Dimmesdale punishes himself because he wants redemption. I find what he is doing...

math
A grocery store is having a promotion for a new brand of milk.Every gallon has a 20% chance of having a coupon for a free box of breakfast cereal under the cap. If Valeria buys 3 gallons of milk,what is the probability that exactly one of them will win her a free box of cereal?

Math
Close, its D

Math
ok so 5x3=15 so there is 6 students so you would do 15 divided by 6. glad to help!

social studies
Like in the 1770s

social studies
How did diaries look like back then?

Language Arts
Yes, the answer is B. Glad to help!

Physics
A 100N force acting on a lever 2m from the fulcrum balances an object 0.5m from the fulcrum on the other arm. What is the weight of the object(in newtons)?What is it's mass (in kg)?

Math
the answer i do believe is to accompany your portfolio A

math
with solution pls...

math
the length of a rectangular mirror is 12 cm longer than its width. find its dimensional if its perimeter is 60cm.

English
Feminists argue that since the past millennium in the West have been dominated by men-whether they be politicians in power or the historians recording it all - Western literature reflects a masculine bias.and consequently, represents and inaccurate and harmful image of women....

English
Even though they are good friends, what is one argument seen in the play "The Night Thoreau Spent in Jail" between Henry and Waldo?

math
yesterday, molly lunch cost $9.80 and she left a $1.49 tip, today molly lunch cost $12.60 if she tips at the same rate that she did yesterday how much of a tip should molly leave

mah
holly spend 7 and 3/5 hours in school each day. her lunch period is 1/2 hour long, and she spends a total of 7/10 hour switching rooms between classes.the rest of her day is spent in 6 classes that are all same length. how long is each class?

English
Im going to base the essay on Edgar Allen Poe as well as Phillis Wheatly.

English
Thank you so much!

English
Im confused as to what two American writers i should form the essay around.

English
(I just need 2 writer ideas) In the middle of the 19th century, political philosopher Alexis de Tocqueville claimed, "The inhabitants of the United States have...properly speaking, no literature." In other words, de Tocqueville believed that America’s literature...

English
Thank you!

English
What is the social context in Edgar Allan Poe’s story, “A Tell-tale heart.”

music appreciation
Who was the first American-born conductor to lead the New York Philharmonic?

Calculas
area between the curves y=4-x^2 and y=x-8

Calculas
what is the velocity (in ft/s) of a sandbag 2.75 s after it is released from a hot-air balloon that is stationary in the air?

French
yes is correct

chemistry
If your car gets 21.4 mpg, how many L of CO2, will you release into the atmosphere, if you drove the 1280miles from Towson University to Key West Florida for a much needed break after taking Chemistry 121? Assume 1.05atm and 17.0C. What would your carbon load be in lbs (lbs of...

chemistry
Can someone please please help me thanks.

chemistry
226.38 x 1000 = 226380mL 226380mL x 0.7025 g/mL = 159031.95grams. I found those result is correct?

chemistry
The gallons I got 59.81 and the L octane 59.81*3.785= 226.38

chemistry
gallons octane to L octane will be #gallons x 3.785 liters right?

chemistry
Can you please do the all things for me please, I really need help. Thank you so much.

chemistry
How to solve for gallons needed?

Macroeconomic
Suppose the current interest rate is 12 percent and a bond with a face value of $500 that pays a coupon rate of 15 percent is selling for $450. Calculate the yield on this bond. How do I calculate the yield on this bond?

math
A 6pack of undershirtsome cost $13.98. This is $3.96 less than the cost of buyingas 6 individual shirts. If each undershirt costs the same amount, how much does each undershirt cost when purchased individually?

language arts
personification-personified is right!! BLANK ISN'T RIGHT

Organic Chemistry
Cu++ forms a blue-green complex with tetraphenylporphin in a 1:1 ratio. Say you have 100 mL of a 2.0 x 10^-4 solution of the Tetraphenylporphin. Exactly what weight of CuCl2 must be added to the solution to insure complete complexation without any excess cupric chloride ...

Child Development
1 - D 2 - B 3 - A 4 - D 5 - A 6 - C 7 - B 8 - D 9 - C 10 - A 11 - D 12 - C 13 - B 14 - A 15 - D 16 - D 17 - A 18 - A 19 - B 20 - A An educator demeaning a student on a public forum, in my opinion, is laughable in regards towards that person's label as a "professional...

Calculus
Here is some of the work so far that I have had helped with: A (3, 0, 0), B (3, 3, 1), C (0, 3, 1) the plane containing these points has normal vector n = <3 -3, 0 -3, 0 -1> x <3 -0, 3 -3, 1 -1> = <0, -3, -1> x <3, 0, 0> = <0, -3, 9> then curl F...

Calculus
A particle moves along line segments from the origin to the points (3, 0, 0), (3, 3, 1), (0, 3, 1), and back to the origin under the influence of the force field F(x, y, z) = z2i + 5xyj + 4y2k. I have tried multiple times to solve this problem but the answer is still not right.

PHI 208
He present specific factual examples that demonstrate harm to the environment

Algebra 2
mdks

language arts
1. B 2. A 3. B 4. C 4/4 100%

Calculas
Johnny is designing a rectangular poster to contain 15 in^2 of printing with a 5-in margin at the top and bottom and a 3-in margin at each side. What overall dimensions will minimize the amount of paper used?

Calculas
A box lid is to be made from a rectangular piece of cardboard measuring 72 cm by 216 cm. Two equal squares of side x are to be removed from one end, and two equal rectangles are to be removed from the other end so that the tabs can be folded to form a box with a lid. Find x ...

Calculas
an open box is to be made from a square piece of cardboard whose sides are 19 inches long,by cutting squares of equal size from the corners and bending up the sides. Determine the size of the aquare that is to be cut out so that the volume may be a maximum.

chemistry
A sample of oxygen gas occupies a volume of 3.84 L at 269. K. What volume will the sample occupy at 486. K?

chemistry
Sodium chloride has properties that are very similar to those of sodium. True or False

Health
1 drink!

Chemistry
In the following reaction, how many liters of carbon dioxide will be produced if 250 liters of oxygen is used in the combustion of sucrose given that both gases are at STP? C12H22O11 + 1202 -> 12CO2 + 11H2O I have had other ones in my homework that were very easy but this ...

Chemistry
When did these scientists make their contributions ? The years Democritus believes that the universe was made of tiny uncuttable particles. Heisenberg works with the Quantum Theory Chadwick finds the missing mass of the atoms nucleus Dalton's believes that atoms of a given...

Calculas
A man 6.5 ft tall approaches a street light 17.0ft above the ground at the rate of 8.00 ft/s. How fast is the end of the man's shadow moving when he is 5.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s

calculas
A man 5.00 ft tall approaches a street light 17.0ft above the ground at the rate of 4.00 ft/s. How fast is the end of the man's shadow moving when he is 9.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s

English
How would you describe someone who keeps blaming someone or something for something tragic and believes that person was responsible for that tragedy without no actual proof and that everybody else knows for a fact that the person is responsible?

Calculas
A 13ft ladder is placed against a verticle wall. Suppose the bottom of the ladder slides away from the wall at a constant rate of 2 feet per second. How fast is the top of the ladder sliding down the wall (negitive rate) when the bottom is 5ft from the wall? The ladder is ...

English
What character trait do you think this quote shows of the narrator in Annabel Lee? The angels, not half so happy in Heaven, Went envying her and me— Yes!—that was the reason (as all men know, In this kingdom by the sea)

Finance
3. Given the following information for Janicek Power Co., find the WACC. Assume the company’s tax rate is 35%. Debt: 8,500 7.2% coupon bonds outstanding, $1000 par value, 25 years to maturity, selling for 118% of par; the bonds make semiannual payments Common Stock: 225,...

Algebra
A woman wishes to invest $12,500 in three types of bonds: municipal bonds paying 8% interest per year, bank investment certificates paying 9%, and high-risk bonds paying 12%. For tax reasons she wants the amount invested in municipal bonds to be at least three times the amount...

Algebra
A confectioner sells two types of nut mixtures. The standard-mixture package contains 100 g of cashews and 200 g of peanuts and sells for $1.85. The deluxe-mixture package contains 150 g of cashews and 50 g of peanuts and sells for $2.45. The confectioner has 15 kg of cashews ...

Biology
Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...

Chemistry
75.0 mL of a 1.40 M solution is diluted to a volume of 248 mL. A 124-mL portion of that solution is diluted using 165 mL of water. What is the final concentration?

Chemistry
68.0g of solute were dissolved in 393 mL of benzene. The solution froze at -0.50°C. The normal freezing point of benzene is 5.5°C and the molar freezing point constant is 5.12°C kg/mol. The density of benzene is .879 g/mol. Calculate the molar mass of the solute.

Chemistry
In a routine laboratory analysis, a solution of sodium chromate with a chromium concentration of 175.0 ppm is required. Calculate the molarity of this solution.

English
What is an example of morbidity in "The Fall Of the House of Usher" by Edgar Allan Poe ? I know what morbidity is but it's hard finding an example in the story so can you please help me find an example of it.

algebra
i appreciate this

algebra
16. Solve y = log3243. A. y = 0 C. y = 5 B. y = 3 D. y = 243 3. Which of the equations below describes the graph shown here? A. y = x – 2 C. y = –x + 2 B. y = x + 2 D. y = –x – 2 11. If the triangles in the following figure are proportional, what is the ...

Gen Chem
In an experiment I used .139 grams of an Alka Selzter table. A question asks us to determine the amount of CO2 dissolved in 5.10ml of 6M HCl. How do you go about solving such a problem?

9th grade math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...

math
This is a 9th grade math problem by the way.

math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...

English - Grammar
What tense is this verb ? The state police were pulling over many drivers? I think its past progressive but i don't know if it would also be considered past perfect progressive. what principle part is used to form the verb in each sentence? 1.The workers will have finished...

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>

Post a New Question