Tuesday
January 27, 2015

Posts by JESSICA


Total # Posts: 2,740

physics
A physical pendulum is constructed of a 48 cm long piece of wooden dowel with a mass of 550 grams and a radius of 0.7 cm. Attached at one end of the pipe is a hoop with a radius of 6 cm and a mass of 1.2 kg as shown. The pendulum is released from the 12:00 position and allowed...
January 23, 2015

English-Scarlet Letter
1.How do the male characters treat, or talk about the female characters? 2.If the female characters had a power what kind will it be? Economical, Psychological, Social, Political , etc and Why? 3. Dimmesdale punishes himself because he wants redemption. I find what he is doing...
January 21, 2015

math
A grocery store is having a promotion for a new brand of milk.Every gallon has a 20% chance of having a coupon for a free box of breakfast cereal under the cap. If Valeria buys 3 gallons of milk,what is the probability that exactly one of them will win her a free box of cereal?
January 21, 2015

Math
Close, its D
January 21, 2015

Math
ok so 5x3=15 so there is 6 students so you would do 15 divided by 6. glad to help!
January 21, 2015

social studies
Like in the 1770s
January 21, 2015

social studies
How did diaries look like back then?
January 21, 2015

Language Arts
Yes, the answer is B. Glad to help!
January 21, 2015

Physics
A 100N force acting on a lever 2m from the fulcrum balances an object 0.5m from the fulcrum on the other arm. What is the weight of the object(in newtons)?What is it's mass (in kg)?
January 19, 2015

math
with solution pls...
January 13, 2015

math
the length of a rectangular mirror is 12 cm longer than its width. find its dimensional if its perimeter is 60cm.
January 13, 2015

English
Feminists argue that since the past millennium in the West have been dominated by men-whether they be politicians in power or the historians recording it all - Western literature reflects a masculine bias.and consequently, represents and inaccurate and harmful image of women....
January 10, 2015

English
Even though they are good friends, what is one argument seen in the play "The Night Thoreau Spent in Jail" between Henry and Waldo?
January 8, 2015

math
yesterday, molly lunch cost $9.80 and she left a $1.49 tip, today molly lunch cost $12.60 if she tips at the same rate that she did yesterday how much of a tip should molly leave
January 7, 2015

mah
holly spend 7 and 3/5 hours in school each day. her lunch period is 1/2 hour long, and she spends a total of 7/10 hour switching rooms between classes.the rest of her day is spent in 6 classes that are all same length. how long is each class?
January 7, 2015

English
Im going to base the essay on Edgar Allen Poe as well as Phillis Wheatly.
January 7, 2015

English
Thank you so much!
January 7, 2015

English
Im confused as to what two American writers i should form the essay around.
January 7, 2015

English
(I just need 2 writer ideas) In the middle of the 19th century, political philosopher Alexis de Tocqueville claimed, "The inhabitants of the United States have...properly speaking, no literature." In other words, de Tocqueville believed that America’s literature...
January 7, 2015

English
Thank you!
January 7, 2015

English
What is the social context in Edgar Allan Poe’s story, “A Tell-tale heart.”
January 7, 2015

music appreciation
Who was the first American-born conductor to lead the New York Philharmonic?
December 21, 2014

Calculas
area between the curves y=4-x^2 and y=x-8
December 21, 2014

Calculas
what is the velocity (in ft/s) of a sandbag 2.75 s after it is released from a hot-air balloon that is stationary in the air?
December 21, 2014

French
yes is correct
December 15, 2014

chemistry
If your car gets 21.4 mpg, how many L of CO2, will you release into the atmosphere, if you drove the 1280miles from Towson University to Key West Florida for a much needed break after taking Chemistry 121? Assume 1.05atm and 17.0C. What would your carbon load be in lbs (lbs of...
December 15, 2014

chemistry
Can someone please please help me thanks.
December 15, 2014

chemistry
226.38 x 1000 = 226380mL 226380mL x 0.7025 g/mL = 159031.95grams. I found those result is correct?
December 15, 2014

chemistry
The gallons I got 59.81 and the L octane 59.81*3.785= 226.38
December 15, 2014

chemistry
gallons octane to L octane will be #gallons x 3.785 liters right?
December 15, 2014

chemistry
Can you please do the all things for me please, I really need help. Thank you so much.
December 15, 2014

chemistry
How to solve for gallons needed?
December 15, 2014

Macroeconomic
Suppose the current interest rate is 12 percent and a bond with a face value of $500 that pays a coupon rate of 15 percent is selling for $450. Calculate the yield on this bond. How do I calculate the yield on this bond?
December 12, 2014

math
A 6pack of undershirtsome cost $13.98. This is $3.96 less than the cost of buyingas 6 individual shirts. If each undershirt costs the same amount, how much does each undershirt cost when purchased individually?
December 10, 2014

Organic Chemistry
Cu++ forms a blue-green complex with tetraphenylporphin in a 1:1 ratio. Say you have 100 mL of a 2.0 x 10^-4 solution of the Tetraphenylporphin. Exactly what weight of CuCl2 must be added to the solution to insure complete complexation without any excess cupric chloride ...
December 9, 2014

Child Development
1 - D 2 - B 3 - A 4 - D 5 - A 6 - C 7 - B 8 - D 9 - C 10 - A 11 - D 12 - C 13 - B 14 - A 15 - D 16 - D 17 - A 18 - A 19 - B 20 - A An educator demeaning a student on a public forum, in my opinion, is laughable in regards towards that person's label as a "professional...
December 8, 2014

Calculus
Here is some of the work so far that I have had helped with: A (3, 0, 0), B (3, 3, 1), C (0, 3, 1) the plane containing these points has normal vector n = <3 -3, 0 -3, 0 -1> x <3 -0, 3 -3, 1 -1> = <0, -3, -1> x <3, 0, 0> = <0, -3, 9> then curl F...
December 8, 2014

Calculus
A particle moves along line segments from the origin to the points (3, 0, 0), (3, 3, 1), (0, 3, 1), and back to the origin under the influence of the force field F(x, y, z) = z2i + 5xyj + 4y2k. I have tried multiple times to solve this problem but the answer is still not right.
December 8, 2014

PHI 208
He present specific factual examples that demonstrate harm to the environment
December 8, 2014

Calculas
Johnny is designing a rectangular poster to contain 15 in^2 of printing with a 5-in margin at the top and bottom and a 3-in margin at each side. What overall dimensions will minimize the amount of paper used?
December 7, 2014

Calculas
A box lid is to be made from a rectangular piece of cardboard measuring 72 cm by 216 cm. Two equal squares of side x are to be removed from one end, and two equal rectangles are to be removed from the other end so that the tabs can be folded to form a box with a lid. Find x ...
December 7, 2014

Calculas
an open box is to be made from a square piece of cardboard whose sides are 19 inches long,by cutting squares of equal size from the corners and bending up the sides. Determine the size of the aquare that is to be cut out so that the volume may be a maximum.
December 7, 2014

chemistry
A sample of oxygen gas occupies a volume of 3.84 L at 269. K. What volume will the sample occupy at 486. K?
December 6, 2014

chemistry
Sodium chloride has properties that are very similar to those of sodium. True or False
December 6, 2014

Chemistry
In the following reaction, how many liters of carbon dioxide will be produced if 250 liters of oxygen is used in the combustion of sucrose given that both gases are at STP? C12H22O11 + 1202 -> 12CO2 + 11H2O I have had other ones in my homework that were very easy but this ...
December 5, 2014

Chemistry
When did these scientists make their contributions ? The years Democritus believes that the universe was made of tiny uncuttable particles. Heisenberg works with the Quantum Theory Chadwick finds the missing mass of the atoms nucleus Dalton's believes that atoms of a given...
December 2, 2014

Calculas
A man 6.5 ft tall approaches a street light 17.0ft above the ground at the rate of 8.00 ft/s. How fast is the end of the man's shadow moving when he is 5.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s
December 2, 2014

calculas
A man 5.00 ft tall approaches a street light 17.0ft above the ground at the rate of 4.00 ft/s. How fast is the end of the man's shadow moving when he is 9.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s
December 2, 2014

English
How would you describe someone who keeps blaming someone or something for something tragic and believes that person was responsible for that tragedy without no actual proof and that everybody else knows for a fact that the person is responsible?
December 2, 2014

Calculas
A 13ft ladder is placed against a verticle wall. Suppose the bottom of the ladder slides away from the wall at a constant rate of 2 feet per second. How fast is the top of the ladder sliding down the wall (negitive rate) when the bottom is 5ft from the wall? The ladder is ...
December 2, 2014

English
What character trait do you think this quote shows of the narrator in Annabel Lee? The angels, not half so happy in Heaven, Went envying her and me— Yes!—that was the reason (as all men know, In this kingdom by the sea)
December 2, 2014

Finance
3. Given the following information for Janicek Power Co., find the WACC. Assume the company’s tax rate is 35%. Debt: 8,500 7.2% coupon bonds outstanding, $1000 par value, 25 years to maturity, selling for 118% of par; the bonds make semiannual payments Common Stock: 225,...
December 2, 2014

Algebra
A woman wishes to invest $12,500 in three types of bonds: municipal bonds paying 8% interest per year, bank investment certificates paying 9%, and high-risk bonds paying 12%. For tax reasons she wants the amount invested in municipal bonds to be at least three times the amount...
November 30, 2014

Algebra
A confectioner sells two types of nut mixtures. The standard-mixture package contains 100 g of cashews and 200 g of peanuts and sells for $1.85. The deluxe-mixture package contains 150 g of cashews and 50 g of peanuts and sells for $2.45. The confectioner has 15 kg of cashews ...
November 30, 2014

Biology
Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...
November 30, 2014

Chemistry
75.0 mL of a 1.40 M solution is diluted to a volume of 248 mL. A 124-mL portion of that solution is diluted using 165 mL of water. What is the final concentration?
November 29, 2014

Chemistry
68.0g of solute were dissolved in 393 mL of benzene. The solution froze at -0.50°C. The normal freezing point of benzene is 5.5°C and the molar freezing point constant is 5.12°C kg/mol. The density of benzene is .879 g/mol. Calculate the molar mass of the solute.
November 25, 2014

Chemistry
In a routine laboratory analysis, a solution of sodium chromate with a chromium concentration of 175.0 ppm is required. Calculate the molarity of this solution.
November 25, 2014

English
What is an example of morbidity in "The Fall Of the House of Usher" by Edgar Allan Poe ? I know what morbidity is but it's hard finding an example in the story so can you please help me find an example of it.
November 24, 2014

algebra
i appreciate this
November 22, 2014

algebra
16. Solve y = log3243. A. y = 0 C. y = 5 B. y = 3 D. y = 243 3. Which of the equations below describes the graph shown here? A. y = x – 2 C. y = –x + 2 B. y = x + 2 D. y = –x – 2 11. If the triangles in the following figure are proportional, what is the ...
November 22, 2014

Gen Chem
In an experiment I used .139 grams of an Alka Selzter table. A question asks us to determine the amount of CO2 dissolved in 5.10ml of 6M HCl. How do you go about solving such a problem?
November 22, 2014

9th grade math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...
November 20, 2014

math
This is a 9th grade math problem by the way.
November 20, 2014

math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...
November 20, 2014

English - Grammar
What tense is this verb ? The state police were pulling over many drivers? I think its past progressive but i don't know if it would also be considered past perfect progressive. what principle part is used to form the verb in each sentence? 1.The workers will have finished...
November 18, 2014

geometric progression
the 3rd term of a gpis 10 and the 6th term is 80 find the common ratio No2 if the 2nd term of a gp is 4 and the 5th term is 1over 16,the7th term is_
November 18, 2014

English
What is the purpose of Annabel Lee by Edgar Allan Poe? What are some qualities and Character traits about of the Speaker in Annabel Lee? I need at least 5. so far I got romantic, dedicated, crazy, and obsessive .
November 16, 2014

English
What is moral lesson in Annabel Lee?
November 16, 2014

Calculus
The maker of an automobile advertises that it takes 11 seconds to accelerate from 15 kilometers per hour to 90 kilometers per hour. Assuming constant acceleration, compute the following. What is the distance the car travels during the 11 seconds (Round your answer to two ...
November 14, 2014

Chemistry (Equilibrium)
ooh, thank you!
November 13, 2014

Chemistry (Equilibrium)
Keq = (0.0855)^2/0.5-0.171 = 0.00731025/0.329 = 0.0222 Keq = 0.0222 is this correct?
November 13, 2014

chemistry
why do we use the limiting reactant data to calculate delta h? why might it be important to know delta h prior to running a reaction?
November 13, 2014

Equilibrium
I get 3.918... so does that mean I round up to 4.0? so the answer would be C?
November 13, 2014

Equilibrium
oh I realized, I have my 0.53M on 2SO2 and not 2SO3. Keq = (0.53-0.30)^2/(0.30)^2(0.15) = 0.26 Is this correct? :)
November 13, 2014

Equilibrium
2 SO2(g) + O2(g) <==> 2SO3(g) Initially, 1.6mol SO3 is placed in a 3.0L container. At equilibrium, [O2] = 0.15M. What is the value of Keq? A. 0.26 B. 1.2 C. 4.0 D. 43 My work: ...2SO2...+...O2...<==>...2SO3 I 0.53M.....-----.........----- C +0.15.....+0.15........-...
November 13, 2014

statistics
I have no idea how to solve this. In a sample of 16 students, 15 were right-handed. Can we construct a 95% confidence interval for the proportion of all students who are right-handed?
November 12, 2014

Chemistry (Equilibrium)
Thanks very much!
November 12, 2014

Chemistry (Equilibrium)
Consider the following equilibrium system at 900°C: H20(g) + CO(g) <==> H2(g) + CO2(g) Initially 5.0 moles of H2O and 4.0 moles of CO were reacted. At equilibrium, it is found that 2.0 moles of H2 are present. How many moles of H2O remain in the mixture? Would be ...
November 12, 2014

Math
Maria has 24ft of fence.she wants to make the lalgest rectangular area possible for her dog.what length should she make each side
November 12, 2014

Algebra 2
How do I solve this using the Quadratic formula and finding the determinant? 1. 5x-6=0 2. x+25=0
November 12, 2014

English
I know this sounds dumb, but what do you call people who are rich but they act normal, don't try to show off at all, and is very kind.
November 11, 2014

Calculus
BoxedNGone truck rentals calculates that its price function is p(x)=160-2x,where p is the price (in dollars) at which exactly x trucks will be rented per day. Find the number of trucks that BoxedNGone should rent and the price it should charge to maximize revenue. Also find ...
November 9, 2014

English (Grammar)
What part of speech is the infinitive phrase used? Is this a noun, adjective, or adverb? 1. The coach's example is one to take seriously. 2. We all made an effort to work harder. 3. The contest requires all entries to be mailed by Thursday. 4. The players were eager to try...
November 9, 2014

Math
You are measuring walnuts for banana walnut oatmeal and a spinach and walnut salad. You need 3/8 cup of walnuts for the oatmeal and 3/4 cup of walnuts for the salad. You have a 1/4-cup scoop. Describe two different ways to find how many scoops of walnuts you will need. PLEASE ...
November 5, 2014

Chemistry
A piece of copper of mass 21.3 g at 106.0 °C is placed in a vessel of negligible heat capacity but containing 53.0 g of water at 19.3 °C. Calculate the final temperature of the water. I keep getting 22 celsius and I'm not sure where I'm going wrong. I plug it ...
November 4, 2014

Math
Determine the exact radian measure for each angle. 40 degrees.
November 4, 2014

Calculus
Find all relative extrema. Use the Second Derivative Test where applicable. f(x)= cosx - x (0,2ð)
November 3, 2014

Chemistry
Calculate the enthalpy change for: C2H4(g) + H2 --> C2H6(g) delta Hrxn: H2(g) + 1/2O2 --> H2O (l) C2H4(g) + 3O2 --> 2H20(l) + 2CO2(g) C2H6(g) + 7/2O2(g) --> 3H20(l) + 2CO2(g) I know I have to flip the third reaction but I dont know what to do next
October 29, 2014

Physics
A volleyball is launched straight up at an initial velocity of 2.3 m/s. It is then spiked by a taller player 0.8 meters above the launch height. How high did it rise, and how long did the volleyball remain in the air between the players?
October 29, 2014

Science
So its the 1st one?:)
October 29, 2014

Science
When evolution was first proposed, which of the following was used as evidence to support the idea? 1.observations of nature 2.laboratory experiments 3.extensive fossil collections 4.genetic sequences I think its either 1 or 4
October 29, 2014

Math
What is the quotien of 148 ➗32 ? Help I need it now
October 28, 2014

Writing
I need help with writing an essay about simple questions, complicated questions, and complex questions. I need to make a topic, write 3-5 paragraphs, describe and explain, write it as an expository essay, and write one paragraph about how it helps us in every day life.
October 28, 2014

algebra math
Which one of the following is a geometric sequence? A. 2, –3, 9⁄2, −18⁄4 B. 0,1,2,3,... C. 8,4,2,1,1⁄2,1⁄4,... D. –7,10,23,36,.. i think the answer is D Can please check it ?
October 28, 2014

Fractions
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of a peach. In the second hour, they sold 1/3 of the remaining peaches plus 1/3 of a peach. In the third hour , they sold 1/4 of what was left and 3/4 ...
October 26, 2014

Math
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of a peach. In the second hour, they sold 1/3 of the remaining peaches plus 1/3 of a peach. In the third hour , they sold 1/4 of what was left and 3/4 ...
October 26, 2014

Chemistry
A buffer solution of volume 100.0 mL is 0.140 M Na2HPO4(aq) and 0.120 M KH2PO4(aq). What are the pH and the pH change resulting from the addition of 55.7 mL of 0.0100 M NaOH(aq) to the buffer solution?
October 21, 2014

Biology
Why can the identity of a compound not be determined by cutting out the spot on an autoradiogram and subjecting it to chemical analysis?
October 21, 2014

Eng
I'm doing project on What are Media racism on Islam & Muslim? Networks etc.and resources where can I can find it Thank you!
October 20, 2014

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Members