Post a New Question

Posts by Aisha

Total # Posts: 144

chemistry
water cannot cook beans on the moon.explain

Science
Which statement correctly describes the sun and earth? a. the sun and earth both have water. b. the sun and earth both have a surface called the crust. c. the sun and earth both have an atmosphere d. the sun and earth both have breathable air

operation and production management
what is meant by "operations" in a. a hospital b. a university c. a commercial bank

Maths bearing
City A is 300km due east of city B ..city C is 200km on a bearing of 123* from city B how far is it from C to A

algebra
peter has n marbles. He has 5 more marbles than Tom. How many marbles does Tom have?

algebra
there are x dozen of oranges in a shop. how many oranges are there in this shop?

algebra
the area of a triangle is 40cm2. the height of it is h cm. what is the lenght of its base?

English
What does the knife symbolize in the story "knife"?

Math- fractions
A cookie recipe calls for 3/4 cup of chocolate chips.Spencer has 2/3 cup. Does he have enough?If your answer is yes ,explain.If your answer is no, how much more does Spencer need?

physics
In Figure 10-1, if the force exerted on a 3.0-kg backpack that is initally at rest is 20.0 N and the distance it acts over is 0.25 m, what is the final speed of the backpack?

Communications 12
When writing an expository paragraph do you put the characters names in quotations?

science
explain to to transfer heat from a electric stove?

math
384,239

algebra
638 divided by 8

Chemistry
15.0 ml of 0.50 M NaOH is added to a 100.-mL sample of 0.442 M NH3 (kb for NH3= 1.8 x 10^-5). What is the equilibrium concentration of NH4+ ions?

History
The U.S. Army at first failed to stop raids by Native Americans for all these reasons EXCEPT? a. it failed to build forts. b. the soldiers were untrained. c.the soldiers were inexperienced. d. it did not have enough soldier

business math
19.52

business math
Joanne and Ed Greenwood built a new barn with an attached arena. To finance the loan, they paid $1,261 interest on $52,600 at 5%. What was the time, using exact interest?

math
6

biology
Looking through a microscope,I saw a Eukaryotic cell. How could I conclude if the cell is a plant or animal cell?

FRENCH
1. On a vendu toutes sortes de choses ici 2. Voici le vendeur qui vend un tee-shirt a Marc 3. Je rend ce jean au vendeur: il est trop petit 4. J’espère que tu ne vas pas perdre le reçu 5. Nous vendons seulement de la bonne qualité, Madame

MATHS
In a triangle ABC, angle B> angle C. If AM is the bisector of angle A and An is perpendicular to BC. Prove that angle MAN=1/2(angle B-angle C).

geography
what does intentional trade have to do with canada's free trade history

geography
new data released on may 27 shows that canada's immigration rate has droped by one point due to ottawa incressing the fee on citizenship application to $500 for a adultfound in ryerson immigration center

geography
what does the drop in canada's imagration rate have to do with learning about imagration and canada's role in it

science
100mL of oxalic acid (H2C2O4) requires 35mL of 0.04M KMnO4 to titrate it to the endpoint. calculate the molarity of the oxalic acid.

Legal Studies
Identify key personnel working in the courtroom.Outline their role.

physics
if an iron cube of volume 400cm3 is immersed in water,the upthrust will be?

chemistry
What would be the MOLARITY (M) of the NaBr in the same buffer solution, if its concentration is now 0.9% (w/v)? Relative atomic masses:Na = 23; Br = 80

physics, math
Don't know

physics
post

physics
A person walk up a stalled escalator in 90sec.when standing on the same escalator now moving,he is carried in 60 sec.the time he would take to walk up the moving escalator will be.

chemistry
or the following reaction, 141 grams of silver nitrate are allowed to react with 20.8 grams of copper.

physics
Force multiply by distance(1)+ force multiply by distance(2)= force multiply by distance(3) 400N multiply by 2m + 600d =700N multiply by 2m 800+600d=1400 600d=1400-800 600d=600 d=1m

Science-2questions
Yes

Science
What is an example of inbreeding? Please tell me.

math
a player made 20 freethrows in first half which was 80% of attemted that half. how many were attempted that half

Math
2 expression for the perimeter of a square 1 with brackets and 1 without The shape is a square and t+3 is 1 side of the square P(with brackets) P(without brackets)

emu
a bullet of mass ..21kg is fired from a gun of a mass 5.6kg. if gun is recoiled at a speed of 2.5 m/s .What speed must the bullet have as it leaves the gun

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a hypothetical ...

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) AATAAA(sequence 5’...

physics
The inverted pendulum shown consists of a uniform rod of length L and mass M hinged at its base. A spring is attached a distance h from the pendulum’s pivot and has a spring constant k. At equilibrium the pendulum is perfectly vertical. For small amplitude oscillations ...

math
Thankyou steve :) but what about the 'b'?

math
i have a test tomorrow and im still not sure how to do this. can you please help me? p={a,b,c} Q={a,c,d,f} Q-P=?

maths
solve 2x+3y=13 with 4x+5y=23

chemistry
2NaOH + H2SO4 yields Na2SO4+2H2O calculate the molarity of H2SO4

Math
yes

Math Help Plaese!!!!!!
dumb butt

Math Help Plaese!!!!!!
You idiot. First, you should not go on things and websites asking help. Just keep your mouth shut. 25 is the answer

science
What is true about the amplitude of a tsunami? A- it increases in shallow water near the shore. B- is is always lower in amplitude that a wave made by wind C- it is high enough to topple ocean liner far out sea. D- in deep water, it is 3 times higher than normal ocean waves.

math
40?

7th grade science
is it C or D?

7th grade science
i mean point, by the way

7th grade science
What could increase the damage to human built structures during an earthquake? A-buildings far away from the pint of origin of the earthquake B- loose material in underlying land C- solid rock beneath buildings D-flexible buildings is it C???

maths
the minute hand of a circular clock is 18cm long how far gdoes the tip of the hand move in 2 hours

maths
the circumference of a circle 314cm find the radius and the area

maths
a circular flower bed is surrounded by a path 3m wide the diameter is 44m what is the area of this path

calculus
i can not simplify further.

calculus
find derivative y= (3x^5-6x^3)/7secx

calculus
where did you get 274 from

calculus
find derivative y= 3x^5-6x^3/7secx find dy/dx * xcosy= 5( y+cosx) * X^5-Y^3+8XY=466 * A RIGHT TRIANGLE HAS LEGS OF LENGTH 15M AND 7M. THE 7M LEG IS NOT CHANGING. 15M LEG IS GETTING LONGER AT RATE OF 8M PER SECOND. SO WHAT IS RATE OF CHANGE OF THE HYPOTENUSE?

math
A blue light every 30seconds. A red light blinks every 40seconds. If both lights blink at exactly 1:00pm, at what time will they blink at the same time again?

chemistry
how to calculate activation energy and frequency factor

7th grade social studies
thanks Ms.Sue!

7th grade social studies
Explain the quote by Samuel de Champlain in your own words. "Through (exploration) we gain knowledge of different countries, regions and kingdoms; through it we attract and bring into our countries all kinds of riches; through it... Christianity (is spread)in all parts ...

ms.sue(social studies)
Ms.Sue about the question of the the Protestant Reformation is it that England was christian and France wasn't or something else (please help)

social studies
I think that since Catholic people didn't like the Protestants in some way conflicts began happening. Then the Catholics fought the French Protestants and that is what led to war???????????????????(not sure)

social studies
Explain how the Protestant Reformation led to war between England and France in the 16th century?

vocabulary
what does vain mean in simple words please?

HELP
no sorry i meant her sea dogs, they were English sailors that would raid Spanish treasure ships (it says in my textbook)

HELP
yes and also another reason which is because of Queen Elizabeth's seahorses, and all

HELP
i said that Philip II of Spain was angry at Queen Elizabeth I of England because he was catholic and England wasn't so he made the Spanish Armada and attacked England, and on and on...

ms.sue
i know how to make a thesis statement but how can you do it for this particular topic please help

HELP
how do you make a thesis statement?

HELP
I am writing and essay for social studies and i only have a conclusion left please help!!!! The essay is about the war of England and Spain in the 1500's their war about cultures and i want to finish this essay so i need help with the conclusion!

2nd grade math
use tally marks first put 8 then 2 and count them all IIIIIIII II the total is........

social studies
thank u sooo much !!!!!!!!!!!!!!!!!!!

social studies
Why did Spain attack, England in the late 1500's? {2 reasons} How did Spain's defeat lead to the weakening of the Spanish Empire?

ela
How can making inferences in literature help you determine how the societal conflicts can make your identity?

the girl who could fly book
Can somebody help me with this question, it is about the book the girl who could fly How can making inferences in literature help you determine how the societal conflicts in I.N.S.A.N.E. shaped Piper's identity?

science-physics
a battery of 12v supplies a charge of 1000C to an electric device. how much work is done by the battery in moving the charge?

statistics
Acrylic bone cement is commonly used in total joint replacement to secure the artificial joint. Data on the force (measured in Newtons, N) required to break a cement bond was determined under two different temperature conditions and in two different mediums appear in the ...

Community service
Help! I need to do 40 hours of community service by 2 weeks. In my nieghborhood there are no libraries, or anything and I have no idea what to do. I need to do this because it is mandatory for honor students like me! The past month went by , because of homework and projects ...

math
Can you help me with this integer problem? -8+6+(-10)+(-2)*(-10) is it 8????

ela
no i didn't want someone else to write something for me i wanted someone to give me a boost up

ela
I need a attention grabber for, a newspaper article. It is based on the giver, it is about a ceremony that is about to begin i need a attention grabber for that.

owning and operating a car
It is important to make sure that any person selling you a car has? A. physical possession of the vehicle. B. informed the motor vehicles department of the intention to sell the vehicle. C. legal title to the vehicle. D. a good reputation for honesty.

Math
ya t is 6 i found the explanation online because i wont be clear "f exactly 5 A's were given in the class, then the students who scored these A's saw their own grade. If six A's had been given then each of the A students could have seen the other 5 A's in ...

science fair
i cant skip the science fair it is mandatory for all or i will fail i need a good project because i am in a honor class

science fair
I need a science fir project!! I looked on a thousand of websites online but they give no interesting idea. I am in 6th grade and i need something at a 6 grade level that is easy a science fair project that is do in 1 week. i am in 6 grade and i don't need experiments ...

math
Steven made 9 napkins out 1 1/2 yards. All the napkins were equal sizes. So based on this information how many yards will it take for Steven to make 30 napkins of equal size?

physics
Part A What velocity was selected? We need to find the velocity so for that we have simple formula v = E/B plug in the numbers we get v = 1.6kV/m / 0.18 T = 8.9 km/s Part b) What is the ion mass? we need to find the ion mass for that we know the formula m = erB²/E = 0.125...

please help me
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion How far did it roll during the first 5.5 s of motion? x=

physics
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion. How far did it roll during the first 5.5 s of motion? Express your answer using two significant figures. x= m

physics
A rocket carrying a satellite is accelerating straight up from the earth's surface. At 1.25 s after liftoff, the rocket clears the top of its launch platform, 69 m above the ground. After an additional 4.80 s , it is 1.00 km above the ground. Calculate the magnitude of the...

physics
An egg is thrown nearly vertically upward from a point near the cornice of a tall building. It just misses the cornice on the way down and passes a point a distance 48.0 m below its starting point at a time 5.00s after it leaves the thrower's hand. Air resistance may be ...

physics
A meter stick is held vertically above your hand, with the lower end between your thumb and first finger. On seeing the meter stick released, you grab it with these two fingers. You can calculate your reaction time from the distance the meter stick falls, read directly from ...

physics
The human body can survive a negative acceleration trauma incident (sudden stop) if the magnitude of the acceleration is less than (m/s2) If you are in an automobile accident with an initial speed of 101(km/h) and are stopped by an airbag that inflates from the dashboard, over...

physics
Ricardo and Jane are standing under a tree in the middle of a pasture. An argument ensues, and they walk away in different directions. Ricardo walks 22.0 in a direction 60.0 west of north. Jane walks 10.0 in a direction 30.0 south of west. They then stop and turn to face each ...

Physics
prongs of a tuning fork when struck

  1. Pages:
  2. 1
  3. 2
  4. Next>>

Post a New Question