Friday
August 1, 2014

Posts by Aisha


Total # Posts: 105

chemistry
or the following reaction, 141 grams of silver nitrate are allowed to react with 20.8 grams of copper.

Science
What is an example of inbreeding? Please tell me.

math
a player made 20 freethrows in first half which was 80% of attemted that half. how many were attempted that half

Math
2 expression for the perimeter of a square 1 with brackets and 1 without The shape is a square and t+3 is 1 side of the square P(with brackets) P(without brackets)

emu
a bullet of mass ..21kg is fired from a gun of a mass 5.6kg. if gun is recoiled at a speed of 2.5 m/s .What speed must the bullet have as it leaves the gun

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a hypothetical tran...

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) AATAAA(sequence 5’...

physics
The inverted pendulum shown consists of a uniform rod of length L and mass M hinged at its base. A spring is attached a distance h from the pendulum’s pivot and has a spring constant k. At equilibrium the pendulum is perfectly vertical. For small amplitude oscillations fr...

math
Thankyou steve :) but what about the 'b'?

math
i have a test tomorrow and im still not sure how to do this. can you please help me? p={a,b,c} Q={a,c,d,f} Q-P=?

maths
solve 2x+3y=13 with 4x+5y=23

chemistry
2NaOH + H2SO4 yields Na2SO4+2H2O calculate the molarity of H2SO4

Math Help Plaese!!!!!!
dumb butt

Math Help Plaese!!!!!!
You idiot. First, you should not go on things and websites asking help. Just keep your mouth shut. 25 is the answer

science
What is true about the amplitude of a tsunami? A- it increases in shallow water near the shore. B- is is always lower in amplitude that a wave made by wind C- it is high enough to topple ocean liner far out sea. D- in deep water, it is 3 times higher than normal ocean waves.

math
40?

7th grade science
is it C or D?

7th grade science
i mean point, by the way

7th grade science
What could increase the damage to human built structures during an earthquake? A-buildings far away from the pint of origin of the earthquake B- loose material in underlying land C- solid rock beneath buildings D-flexible buildings is it C???

maths
the minute hand of a circular clock is 18cm long how far gdoes the tip of the hand move in 2 hours

maths
the circumference of a circle 314cm find the radius and the area

maths
a circular flower bed is surrounded by a path 3m wide the diameter is 44m what is the area of this path

calculus
i can not simplify further.

calculus
find derivative y= (3x^5-6x^3)/7secx

calculus
where did you get 274 from

calculus
find derivative y= 3x^5-6x^3/7secx find dy/dx * xcosy= 5( y+cosx) * X^5-Y^3+8XY=466 * A RIGHT TRIANGLE HAS LEGS OF LENGTH 15M AND 7M. THE 7M LEG IS NOT CHANGING. 15M LEG IS GETTING LONGER AT RATE OF 8M PER SECOND. SO WHAT IS RATE OF CHANGE OF THE HYPOTENUSE?

math
A blue light every 30seconds. A red light blinks every 40seconds. If both lights blink at exactly 1:00pm, at what time will they blink at the same time again?

chemistry
how to calculate activation energy and frequency factor

7th grade social studies
thanks Ms.Sue!

7th grade social studies
Explain the quote by Samuel de Champlain in your own words. "Through (exploration) we gain knowledge of different countries, regions and kingdoms; through it we attract and bring into our countries all kinds of riches; through it... Christianity (is spread)in all parts o...

ms.sue(social studies)
Ms.Sue about the question of the the Protestant Reformation is it that England was christian and France wasn't or something else (please help)

social studies
I think that since Catholic people didnt like the Protestants in some way conflicts began happening. Then the Catholics fought the French Protestants and that is what led to war???????????????????(not sure)

social studies
Explain how the Protestant Reformation led to war between England and France in the 16th century?

vocabulary
what does vain mean in simple words please?

HELP
no sorry i meant her sea dogs, they were English sailors that would raid Spanish treasure ships (it says in my textbook)

HELP
yes and also another reason which is because of Queen Elizabeth's seahorses, and all

HELP
i said that Philip II of Spain was angry at Queen Elizabeth I of England because he was catholic and England wasn't so he made the Spanish Armada and attacked England, and on and on...

ms.sue
i know how to make a thesis statement but how can you do it for this particular topic please help

HELP
how do you make a thesis statement?

HELP
I am writing and essay for social studies and i only have a conclusion left please help!!!! The essay is about the war of England and Spain in the 1500's their war about cultures and i want to finish this essay so i need help with the conclusion!

2nd grade math
use tally marks first put 8 then 2 and count them all IIIIIIII II the total is........

social studies
thank u sooo much !!!!!!!!!!!!!!!!!!!

social studies
Why did Spain attack, England in the late 1500's? {2 reasons} How did Spain's defeat lead to the weakening of the Spanish Empire?

ela
How can making inferences in literature help you determine how the societal conflicts can make your identity?

the girl who could fly book
Can somebody help me with this question, it is about the book the girl who could fly How can making inferences in literature help you determine how the societal conflicts in I.N.S.A.N.E. shaped Piper's identity?

science-physics
a battery of 12v supplies a charge of 1000C to an electric device. how much work is done by the battery in moving the charge?

statistics
Acrylic bone cement is commonly used in total joint replacement to secure the artificial joint. Data on the force (measured in Newtons, N) required to break a cement bond was determined under two different temperature conditions and in two different mediums appear in the follo...

Community service
Help! I need to do 40 hours of community service by 2 weeks. In my nieghborhood there are no libraries, or anything and I have no idea what to do. I need to do this because it is mandatory for honor students like me! The past month went by , because of homework and projects an...

math
Can you help me with this integer problem? -8+6+(-10)+(-2)*(-10) is it 8????

ela
no i didn't want someone else to write something for me i wanted someone to give me a boost up

ela
nice

ela
I need a attention grabber for, a newspaper article. It is based on the giver, it is about a ceremony that is about to begin i need a attention grabber for that.

owning and operating a car
It is important to make sure that any person selling you a car has? A. physical possession of the vehicle. B. informed the motor vehicles department of the intention to sell the vehicle. C. legal title to the vehicle. D. a good reputation for honesty.

Math
ya t is 6 i found the explanation online because i wont be clear "f exactly 5 A's were given in the class, then the students who scored these A's saw their own grade. If six A's had been given then each of the A students could have seen the other 5 A's in ...

science fair
i cant skip the science fair it is mandatory for all or i will fail i need a good project because i am in a honor class

science fair
I need a science fir project!! I looked on a thousand of websites online but they give no interesting idea. I am in 6th grade and i need something at a 6 grade level that is easy a science fair project that is do in 1 week. i am in 6 grade and i don't need experiments fro...

math
Steven made 9 napkins out 1 1/2 yards. All the napkins were equal sizes. So based on this information how many yards will it take for Steven to make 30 napkins of equal size?

please help me
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion How far did it roll during the first 5.5 s of motion? x=

physics
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion. How far did it roll during the first 5.5 s of motion? Express your answer using two significant figures. x= m

physics
A rocket carrying a satellite is accelerating straight up from the earth's surface. At 1.25 s after liftoff, the rocket clears the top of its launch platform, 69 m above the ground. After an additional 4.80 s , it is 1.00 km above the ground. Calculate the magnitude of the...

physics
An egg is thrown nearly vertically upward from a point near the cornice of a tall building. It just misses the cornice on the way down and passes a point a distance 48.0 m below its starting point at a time 5.00s after it leaves the thrower's hand. Air resistance may be ig...

physics
A meter stick is held vertically above your hand, with the lower end between your thumb and first finger. On seeing the meter stick released, you grab it with these two fingers. You can calculate your reaction time from the distance the meter stick falls, read directly from th...

physics
The human body can survive a negative acceleration trauma incident (sudden stop) if the magnitude of the acceleration is less than (m/s2) If you are in an automobile accident with an initial speed of 101(km/h) and are stopped by an airbag that inflates from the dashboard, over...

physics
Ricardo and Jane are standing under a tree in the middle of a pasture. An argument ensues, and they walk away in different directions. Ricardo walks 22.0 in a direction 60.0 west of north. Jane walks 10.0 in a direction 30.0 south of west. They then stop and turn to face each ...

Physic 101
A jetliner lands at speed of 210 km/h and breaks at rate of 20 km/h/s . If the jatliner travels at a constant speed of 210 km/h for 1s after landing before applying the breakes . What is the total displacement of the jetliner between couchdown on the runway and coming to rest ?

Science collage
A jetliner lands at speed of 210 km/h and breaks at rate of 20 km/h/s . If the jatliner travels at a constant speed of 210 km/h for 1s after landing before applying the breakes . What is the total displacement of the jetliner between couchdown on the runway and coming to rest ?

chemistry
what volume of 0.1 moldm-3 HCL acid would be required to dissolve 2.3 grams of calcium carbonate equation CaCO3+2HCL----------=CaCl2+CO2+H20 (WATER)

math213
In each of the following, order decimals from least to greatest a.24,9419, 24.942, 24,94189, 24.94199 b.-34.25, -34.251, -34.205, -34.2519

math
Convert eat of the following repeating decimal to a/b form, where a and b are integers and b doesn't equal 0. a. 0.7 c. 2.37 e. -4.34

physics
A cyclist is cycling at a uniform velocity of 8m/s for 8 seconds. He then stops paddling and the cycle comes to rest in next ten seconds. Draw the velocity-time graph and calculate: (i) the average retardation.(ii) the distance covered with uniform velocity.(iii) the distance ...

Devry
One of your corporate clients has approached you about whether or not its employees are required to include certain benefits provided by the corporation in their income. In particular, the corporation has inquired whether the following benefits provided by the corporation to e...

Geometry
Find The coordinates of G'reflected in the x-axis if the coordinates of G are (4,-3)

geometry
sketch label and mark each figure 1.Isoscles obtuse triangle TRI with vertex angle T. 2.Rhombus RHOM with acute <H and the shorter diagonal. 3.Scalene right triangle SCA with midpoints L,M and N on SC, CA, and SA, respecitively. 4.Trapeoziod TRAP with TR|| A[, RE PA and P,...

geometry
What are the values of a and b.if any,where a|b-2|<0? please some sugestions

geometry
From the top of a lighthouse 210 feet high, the angle of depression to a boat is 27 degress. Find the distance from the boat to the food of the lighthouse. The lighthouse was built at sea level? Please help and for some sugesstions

English
In Literature, what were the goals in the Harlem Renaissance? I could only think of one. -To show the Negro as a capable individuals

business managment
how might a walmart representative respond to the negetive criticism that might arise as result of sighting a new facility in a community ranging from traffic congestion to anti-union sentiment to unfair competition?

AP Biology- Molecular Genetics
Q2:(The(sequence(below(begins(with(the(initiator(methione. ATG(TTC(AAT(GTT(ATG(GAT(TGG(CCC(TGG(TAA(ATG(AAA(TAGAATGAT 4pts.(Please(give(a(hypothetical(translation(of((cDNA(sequence(into(single( amino(acid(codes(if(there(is(a(C(deletion(in(the(phenylalanine(codon _______________...

maths
the length of a rectangle is 3 less than 5 times its width. Write a simpified algebriac expression for the perimeter of a rectangle. If the rectangle width is tripled and its length is doubled,the perimeter of new rectangle is 92cm greater than the original perimeter. Find the...

11th grade english
What is a good thesis statement on the destruction of world due to food we eat for my critical analysis paper?

social studies
the form of government used in most of louisisana's parishes is called what

social studies
the process of redrawing the boundaries of legislative districts is called what

Social Studies
the form of government used in most of louisisana's parishes is called what

Social Studies
A document that sets up broad organization of a government and the rules under which it will operate is called what.

ETH/125
Checkpoint: Legislation Legacy Resources: National Congress of American Indians Web site Country Newspaper at · Due Date: Day 5 (Friday) Please post in your Individual Forum · Post a 200- to 300-word summary of a current issue between Native Americans and the fed...

sci/275
research due day 2 (tuesday) wk 6 sci/275 Exercise: Final Paper Research Due Day 2 (Tuesday) Please post in your Individual Forum · Resource: Appendix A · Review the environmental issues that are covered in this course. · Choose an environmental issue tha...

SCI/275
CheckPoint #6: Water Resource Challenges Due Thursday *Post as an attachment** in your Individual Forum . Water Resource Challenges Review Ch. 10 and 11 of your text, then complete the following: Provide at least three freshwater and three ocean water resource challenges by fi...

college Math
(x-y)/(4x+3y)=6x find dy/dx by implicit differentiation.

algebra 2
determine whether the data in the table appears to be positively skewed, negatively skewed, or normally distributed. explain

algebra 2
Evaluate C(12,10)

algebra2
solve: 8 t - 3 1 - ---- = ------ + ---- t + 5 t + 5 3

algebra2
list all of the possible rational zeros of f(x) = 3x^5 - 7x^3 + 2x - 15.

algebra2
state the number of positive real zeros, negative real zeros, and imaginary zeros for g(x) = 9x^3 - 7x^2 +10x - 4

Geometry
Find the coordinates of the midpoint of the segment whose endpoints are (-4, 6) and (-8, -2).

geography
provinces, teritorries, and capitals of each.

3rd grade math
noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo...

Science
With reference to the chemical- physical structure of DNA, and the nature and importance of a stable genetic code, describe the major forms of chromosomes mutations; also, describe, using examples: the major categories/types of mutagenic agents and how these affect genetic cha...

General Chemestry
Diacetyl, a substance contributing to characteristic flavor and aroma of butter, consist of 55.8% C, 7.03% H, and 37.17% O. In the gaseous state at 100 C and 747 torr, a 0.30 gram sample occupies a volume of 111ml. What is the molacular formula of diacetyl?

Algebra 2
a2x+5a2x2-2ax

african history
the colonizers were the british people, Africans became slaves because they were forced by the british people and on the other side they had no choice.

Pages: 1 | 2 | Next>>

Search
Members