Friday
May 6, 2016

Homework Help: Health: First Aid

Recent Homework Questions About First Aid

maths
I need explanation to this question.solve 48 base12 multiply by 15 base12.i can solve it by first converting to base ten and back to base 12,but i need to be able to solve directly in base12.Thanks
Tuesday, September 29, 2015 by james

College Algebra
1 - 1 = 1 ______________________________________ 4x-12 2x-6 x^2-3x Solve the equation (its subtracting the first two fractions and equalling the last fraction)
Tuesday, September 29, 2015 by Tim

Physics
A stone is dropped from the roof of a building: 2.5s after, a second stone is thrown straight down with an initial speed of 24m/sec, and the two stones lands at the same time. (A) how long did it take the first stone to reach the ground
Monday, September 28, 2015 by Sasa

math
In how many ways can 6 students be seated in a row of 6 chairs if Shane insists on sitting in the first chair?
Monday, September 28, 2015 by maritza

math
Can someone show me how to answer this question? Please? I would really appreciate any help you can give baseball statistics~~ “According to an Associated Press study, the average MLB salary will break the $4 million mark for the first time in 2015, continuing a trend ...
Monday, September 28, 2015 by Abby

H S Algebra
Kelly made a 94 and an 80 on the first two science tests. What does she need to make on the third test to have at least a 90 average in the class?
Monday, September 28, 2015 by Norman

Math
Abia is one of three servers who work at a restaurant that is open from tuesday to sunday. Every week the servers randomly draw slips of paper from a hat to decide which two days they won't have to work, in addition to monday. What is the conditional probability that Abia ...
Monday, September 28, 2015 by Polly

Math
Two teams are playing in a best of seven playoff series. The first team to win four games wins the series. Ties are broken through sudden decision overtime. If the teams are evenly matched: What are the odds in favour of either team sweeping the series, in which one team wins ...
Monday, September 28, 2015 by Laure

English
Identify the choice that best describes the word "he" When Carlos presented the report to the class, he brought in samples of the foods. first-person pronoun second-person pronoun*** third-person pronoun reflexive pronoun *** - My Answer
Monday, September 28, 2015 by Kaai97

math
Can someone show me how to answer this question? Please? I would really appreciate any help you can give baseball statistics~~ “According to an Associated Press study, the average MLB salary will break the $4 million mark for the first time in 2015, continuing a trend ...
Monday, September 28, 2015 by Abby

math
can someone show me how to figure these literal equation out? I did them before but my teacher said they were incorrect. Questions~~ Solve the following formula for the variable indicated 9. r = d/t, where r = rate, d = distance, and t = time for d ( I didn’t know how to ...
Monday, September 28, 2015 by Abby

math
can someone help me figure these literal equation out? I did them before but my teacher said they were incorrect. Questions~~ Solve the following formula for the variable indicated 9. r = d/t, where r = rate, d = distance, and t = time for d ( I didn’t know how to answer ...
Monday, September 28, 2015 by Abby

math
The sum of two numbers is -62. Twice the first minus the second is 41. Find the numbers.
Monday, September 28, 2015 by shaneika

chemistry
A student determines the zinc content of a solution by first precipitating it as zinc hydroxide, and then decomposing the hydroxide to zinc oxide by heating. How many grams of zinc oxide should the student obtain if her solution contains 38.0 mL of 0.501 M zinc nitrate?
Monday, September 28, 2015 by Julian

Math
PLEASE HELP ASAP!!! 1 rectangular prism has a base area of 120 square feet, a height of 12 feet per second and has dimensions of 84 inches, 6 feet, and 16 feet. Is the volume of the second more than or less than half that of the first? now explain
Sunday, September 27, 2015 by Kim

math
can you please check my work. sorry to repost but I was skipped over earlier and just want to know if I did this correctly? A scientist uses a submarine to study ocean life. She begins at sea level, which is at an elevation of 0 ft. she travels straight down at a speed of 3....
Sunday, September 27, 2015 by sara7

reading
30-day Money Back Guarantee Groom Co. electric shavers come with a 30-day money back guarantee. The only stipulation is that you use your new exclusively for 2 weeks to become accustomed with the product. If you are not satisfied, we will refund the amount on your receipt if ...
Sunday, September 27, 2015 by Joshua

Math
A salesperson's weekly paycheck is 25% less than a second salesperson's paycheck. The two paychecks total $1425. Find the amount of each paycheck. first salesperson's paycheck ? second salesperson's paycheck?
Sunday, September 27, 2015 by Kathy

Math
Every 12th customer at a Chicago deli gets a free soda. Every 15th customer gets a free bagel. Which is the first customer to get a free bagel and free soda? Please help!!!
Sunday, September 27, 2015 by Keesha

Health
Which of the following secondary sex characteristics do not develop during the teen years? (1 point) development of breasts in girls development of body hair in boys development of ovaries in girls and testes in boys development of acne in boys 2. What is the primary cause for...
Sunday, September 27, 2015 by Shalee ^~^

Health PLEASE HELP
Hi, can some one check my health answers? I answered all the questions, I would just like some one to check them :) btw I go to connections academy. 1.Which of the following secondary sex characteristics do not develop during the teen years? (1 point) development of breasts in...
Sunday, September 27, 2015 by KawaiiLightlee

math
can you please check my work. A scientist uses a submarine to study ocean life. She begins at sea level, which is at an elevation of 0 ft. she travels straight down at a speed of 3.5ft per second. she then travels directly up 30seconds at a speed of 2.2ft per second. 1) after ...
Sunday, September 27, 2015 by sara7

public speaking
What type of visual aid is showing the actual thing being discussed? A. Photograph B. Graph C. Object D. Videotape
Sunday, September 27, 2015 by Anonymous

PE
You discover a red bump on your leg that itches. You decide to research the symptoms. While researching, you discover contradictory information. What is the best next step? Assume the bump is life threatening and call the doctor.*** Implement the solution from the first source...
Sunday, September 27, 2015 by Stacy

Physics
A mover has to move a heavy sofa of mass 146 kg to the second floor of the house. He uses a rope to pull the sofa up a ramp from the first to the second floor. As he pulls the sofa he makes sure that the rope is parallel to the surface of the ramp which is at 30.0° to the ...
Sunday, September 27, 2015 by Anna

Maths: Sequences need help
The nth term of a sequences of v1,v2,v3 is given by Vn=6 2^n (1):show that for all value of n>1 Vn1=2(Vn-3)?? (2): obtain and simplify the sum of the first n term of the sequence??
Saturday, September 26, 2015 by Collins

lgebra
The sum of three consecutive natural numbers is 963, find the numbers. (A) First, write out an equation that models the relationship between these three numbers: x + ____ +______ = 963 2nd number 3rd number (B) Now, simplify the left side of your equation: ____________ = 963 (...
Saturday, September 26, 2015 by NINA

Maths word problem need help
In order to save one million naira for the purchase of some goods a man save #1,#2,#4 #8 on the first,second,third and fourth day respectively.At this rate assuming that no interest was added (a):what amount was saved on the 15th day? (b):at least how many days were needed to ...
Saturday, September 26, 2015 by Collins

Phyics
A particle, which starts from rest, covers a distance of 19.94 cm in the first 8.6 seconds. Find the acceleration (in m/s2) of the particle at the end of 8.6 seconds.
Saturday, September 26, 2015 by Susan

Science
I have homework in which it asks "Describe the difference between elements, mixtures and compounds. (I have done the first sentence as it was fairly easy. Next is the part I don't understand) You need to draw their chemical formulae (for example KCl for potassium ...
Saturday, September 26, 2015 by Ryan

Finance
DBP Inc. just paid a dividend of $2.50. The expected growth rate of dividend is 5 percent. The required return for investors in the first three years is 12 percent and 10 percent for the following three years. After those six years the required return is 8 percent. What is the...
Saturday, September 26, 2015 by Jack

chemistry
The temperature at which crystal will first appear when a solution is cooled from 60°c to 20°c?
Saturday, September 26, 2015 by Anonymous

chemistry
The temperature at which crystal will first appear when a solution is cooled from 60°c to 20°c?
Saturday, September 26, 2015 by Anonymous

Calculus
Just got through with derivatives, power rule, and chain rule. I am supposed to find the first and second derivatives of the function. y = 4x/√x+1 and y = cos^2(x) y' = [(x+1)^(1/2)(4)]-[(4x)(1/2(x+1)^(-1/2))(​1)] y' = [4(x+1)^(1/2)-4x]/[2(x+1)^(1/2)(x+1)] ...
Saturday, September 26, 2015 by Justin

eced
The rate of physical growth is slow during which period of life? Prenatal development. B.the first year of life. C. Preschool and elementary years. I am think c.
Friday, September 25, 2015 by woody

child development
Which of the following statements concerning the maturation of the reproduction systems is true? A.early menstrual are usually normal.b.in the first months of me strutting girls do not usually ovulate. C. At about 17 boys have their first spontaneous ejaculaTion. I am think c
Friday, September 25, 2015 by Woody

English 11
Check my answers please! 1. Which of the following statements about American Romanticism is nottrue? (1 point) Romanticism in American literature stemmed from Romanticism in British literature.*** Romanticism valued imagination and emotion over reason and intellect. Gothic ...
Friday, September 25, 2015 by Rach

biology-microscope
1. should the aperture diaphragm be adjusted to its most open or its least open setting, to begin? 2.where should the stage be set when you first observe the specimen, using the low power objective lens?
Friday, September 25, 2015 by Anonymous

calculus
Find the point on the curve y =2/3 〖√(18-x^2 )〗 (first quadrant) where a tangent line may be drawn so that the area of the triangle formed by the tangent line and the coordinate axes is a minimum.
Friday, September 25, 2015 by Anonymous

P6 maths
40% of Amy's stamps is equal to 75% of Mary's stamps. After Mary has given 25% of her stamps away , Amy has 90 more stamps than Mary. Find the total number of stamps they have at first
Friday, September 25, 2015 by Jane

Physics
In 1939 or 1940, Emanuel Zacchini took his human-cannonball act to an extreme: After being shot from a cannon, he soared over three Ferris wheels and into a net (see the figure). Assume that he is launched with a speed of 29 m/s and at an angle of 59°. (a) Treating him as ...
Friday, September 25, 2015 by barich

Physics
An incline is divided into 6 equal lengths. Starting from rest a ball accelerates down the incline. It takes 0.21 seconds to reach the first tape marker, a distance of 0.15 meter.
Friday, September 25, 2015 by Sarah

English
Posted by rfvv on Sunday, April 10, 2011 at 9:51pm. He asked me a question. He asked a question of me. He begged me a question. He begged a question of me. He inquired me a question. He inquired me of a question. (Are the pairs all correct and interchangable? Doe they have the...
Thursday, September 24, 2015 by rfvv

biology
Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription is the first step in ...
Thursday, September 24, 2015 by help please

math
Assume you have a basket full of socks, which have the following properties: 6 of the socks have blue stripes 8 of the socks have red polka dots 16 of the socks have blue polka dots 10 of the socks have red stripes (a). If you take one sock out of the basket, what is the ...
Thursday, September 24, 2015 by jordan

Math
Sherry saved $1800 she earned at her summer job. She invested part of her money in a Treasury Bill at 5% and the balance in a Money Market fund which guaranteed a return of 10%. If she earned $165 on her investments in the first year, how much was invested at each rate?
Thursday, September 24, 2015 by Karl

Physics?
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Thursday, September 24, 2015 by Jay

Physics
A car, moving along a straight stretch of high- way, begins to accelerate at 0.014 m/s2. It takes the car 23.2 s to cover 1 km. How fast was the car going when it first began to accelerate? Answer in units of m/s.
Thursday, September 24, 2015 by Bob

Learning Behaviors
describe the temporal pattern of a typical emotional response, occording to the opponet process theory of solomon and corbit.use this theory to account for the different reactions experienced by a first time drug user and an experienced drug user providing two supporting facts...
Thursday, September 24, 2015 by Sabxo

kumasi polytechnic
In A.P the difference between the 8th term and 4th term is 20,and the 8th term is one and half times the 4th term.Find the common difference, and the first term.
Thursday, September 24, 2015 by adjei

biology
Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription is the first step in ...
Thursday, September 24, 2015 by SOS

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
Thursday, September 24, 2015 by Stephanie

Chemistry
Separation of a mixture Lab - SiO2, NaCl, NH4Cl So step #7 was: Carefully pour off (decant) the liquid into the second evaporation dish, Adding deionized water in small amounts to the first dish and to stir it, and pour the liquid again into the second dish. Repeating it. The ...
Wednesday, September 23, 2015 by Abby

Physics
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Wednesday, September 23, 2015 by Jason

Physics(which cone will land first)
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Wednesday, September 23, 2015 by Jason

Algebra
A type of plant is introduced into an ecosystem and quickly begins to take over. A scientist counts the number of plants after m months and develops the equation p(m)=19.3(1.089) raised to m, to model the situation. Most recently, the scientist counted 138 plants. Assuming ...
Wednesday, September 23, 2015 by Lina

Math
Paul was given this math problem on a test to simplify: 1/4 + (5/8 + 1/2). after calculating, Paul mistakenly simplified to 9/32 as his final answer In which step did Paul make his first error? Show your work! My work Paul's work 1/4 /9/8 1/4 /(5/8 + 4/8) 1/4 x 8/9 1/4 + 8...
Wednesday, September 23, 2015 by Steve B

Physics
A descent vehicle landing on the moon has a vertical velocity toward the surface of the moon of 34.1 m/s. At the same time, it has a horizontal velocity of 51.1 m/s. At what speed does the vehicle move along its descent path? 1.Answer in units of m/s. 2.At what angle with the ...
Wednesday, September 23, 2015 by Brandon

math
find X if the numbers X+3, 5x-3, and 7x+3 are three consecutive terms of a G.P of positive terms. with this value X and given the X+3, 5x -3 and 7x +3 are the third, fourth and fifth terms of the G.P.. find the sum of the first 8 terms of the progression.
Wednesday, September 23, 2015 by mili

math
You decide you will buy a stock only if it shows an overall increase over the next 30 days. The first 10 days it has an average daily increase of $0.30. The next 10 days it has an average daily decrease of $0.45. The last 10 days it has an average daily increase of $0.25. Will...
Wednesday, September 23, 2015 by SE

probabilty
There are 4 baskets. The first basket has 3 apples and 4 oranges, the second one has 4 apples and 5 mangoes, the third one has 6 Mangoes and 2 bananas and the last one has 7 bananas and 2 apples. If a fruit is randomly chosen from any basket and it comes out to be an apple, ...
Wednesday, September 23, 2015 by sarita

Math
In a third game. Javier first two darts land in R what is the maximum possible score in this game
Wednesday, September 23, 2015 by Sean

Physics
The velocities of sound in media P and Q are 300 meters/second and 350 meters/second respectively. If the difference in wavelength of the two waves in those media is 0.5 meters, what distance will the sound travel in 50 vibrations in the medium Q? The first answer I got was ...
Wednesday, September 23, 2015 by Anon

physics
a cart if weight 25 N is released at the top of an inclined plane of length 1m, which makes an angle of 30 degree with the ground. It rolls down the plane and hits another cart of weight 40 N at the bottom of the incline. Calculate the speed of the first cart at the bottom of ...
Wednesday, September 23, 2015 by ancy

math
what is 7 to the 6th power divided by 7 to the first power.
Wednesday, September 23, 2015 by alex

chemistry/engineering
Wet sugar, containing one-fifth water by mass is conveyed through an evaporator in which 85.0% of the entering water is vaporized. Taking a Basis of 100 kg of feed to the evaporator A barrel of oil contains about 6 million Btu and about 1000 Btu is needed to evaporate one lbm ...
Tuesday, September 22, 2015 by katy

Physics
The tortoise and the hare are in a race of 1000m distance. The tortoise travels the entire race at a speed of 2.0 m/s while the rabbit runs the first 200 m @ 2.0 m/s. Then he stops to take nap for 1.3 hrs and awakens to finish the last 800m with an average speed of 3.0 m/s. ...
Tuesday, September 22, 2015 by Karen

algebra
An “A” is considered 4.0, a “B” is 3.0, a “C” is 2.0, a “D” is 1.0, and an “F” is 0. In your first semester you received the following grades. Calculate your grade point average English = credits 3.0 Grade = C Biology = credits...
Tuesday, September 22, 2015 by Kristen

algebra
Bacteria of species A and species B are kept in a single test tube, where they are fed two nutrients. Each day the test tube is supplied with 19,740 units of the first nutrient and 31,990 units of the second nutrient. Each bacterium of species A requires 4 units of the first ...
Tuesday, September 22, 2015 by Jamie

Half-Life
The rate constant for this first-order reaction is 0.0990 s–1 at 400 °C. A --> products After how many seconds will 10.0% of the reactant remain?
Tuesday, September 22, 2015 by Sam

Geometry
How to put each circle in standard form? 1. Center of the line 5x-3y=12 and tangent to both axes.(first quadrant circle only). 2.passes through (-3,22) and tangent to the y axis at (0,19) 3.diameter ab with a (4,10) and b (8,14) 4. Center (6,10) tangent to the x axis
Tuesday, September 22, 2015 by Please HELP

Please help with this 1
A football team has a net yardage of -26 1/3 yards of a series of plays. The team needs to get yardage of 10 yards to get a first down. How many yards do they have to get on their next play to get a first down?
Tuesday, September 22, 2015 by Step hie

Math
From January 1, 2000 to December 31, 2004, First Bank paid 5% interest, compounded monthly. On January 1, 2005, they lowered their rate to 3% interest, compounded monthly. I deposited $100 at the end of each month beginning in January, 2000. How much did I have in my account ...
Monday, September 21, 2015 by Anon

prealgebra
A school library charges a fine of 5 cents on the first day a book is overdue, then doubles the amount owed each day until payment is made. Jada and Juan each had a book that was overdue. Jada paid a fine that was $2.40 more than Juan’s fine. Which statement about the ...
Monday, September 21, 2015 by Anonymous

physics
Another scheme to catch the roadrunner has failed. A safe falls from rest the top of a 30.2 m high cliff toward Wiley Coyote, who is standing at the base. Wiley first notices the safe after it has fallen 17.4 m. How long does he have to get out of the way? The acceleration of ...
Monday, September 21, 2015 by luma

Punctuation and Capitalization
. Which one of the following sentences has an error in capitalization? A. We crossed the Snake River and miles of nothing much on our way to Abilene. B. That day, across the great river, we got our first view of the Washington Monument. C. My Father has decided to retire in ...
Monday, September 21, 2015 by Anonymous

English
Posted by rfvv on Tuesday, August 26, 2014 at 1:27am. 1. I'll be there(=in prison) for seven years for making fake money. 2. I'll be there (=in prison) for seven years for having made fake money. (Which expression is grammatical?) English - Steve, Tuesday, August 26, ...
Sunday, September 20, 2015 by rfvv

AP Chemistry
An unknown amount of water is mixed with 350 mL of a 6 M solution of NaOH solution. A 75 mL sample of the resulting solution is titrated to neutrality with 52.5 mL of 6 M HCl. Calculate the concentration of the diluted NaOH solution. Answer in units of M I didn't know what...
Sunday, September 20, 2015 by Anonymous

math for managers
f 5 times the first number plus 3 times the second number equals 47, and 10 times the first number minus 4 times the second number equals 54, what are the numbers?
Sunday, September 20, 2015 by Anonymous

math foe managers
f 5 times the first number plus 3 times the second number equals 47, and 10 times the first number minus 4 times the second number equals 54, what are the numbers?
Sunday, September 20, 2015 by Anonymous

Physics
A 0.340 kg particle moves in an xy plane according to x(t) = -15.00 + 2.00t - 4.00t3 and yet) = 25.00 + 7.00t - 9.00t2, with x and y in meters and t in seconds. At t = 0.700 s, what are (a) the magnitude and (b) the angle (relative to the positive direction of the x axis) of ...
Sunday, September 20, 2015 by Haad

physics
A 15-V battery is hooked up to three resistors in series. The voltage drop across the first resistor is 3V and the voltage drop across the sencond resistor is 10V. What is the voltage drop across the last resistor? I don't understand what equation to do for this problem. ...
Saturday, September 19, 2015 by Grace

Social Studies
The leaders of the Virginia Company recruited more settlers and reorganized the colony. They allowed the new settlers to own land. Those settlers began to grow tobacco, a crop they learned about from the Indians. By 1612, Virginians were shipping tobacco to England, which led ...
Saturday, September 19, 2015 by Trent Brown

History
The Caddo lived on a million acres of land. What characteristics of their culture demonstrated a need for vast amounts of land? A. They made and traded intricate pottery. B. They hunted Bison and raised cattle, hogs, and poultry on farms. C. They worked on boats along shores. ...
Saturday, September 19, 2015 by Shi Buringa

English
Jay Z has multiple sides to him; he teaches us how to be a successful person, and show us what's important in life v.s. what's not. Is this a good thesis sentence, and also can you give me example of the first part of the sentence and the last part ofd the sentence
Saturday, September 19, 2015 by Mrs. Keon Meadows

Science- Physics
Two plane mirrors, A and B, are separated by 30.0 cm facing each other. An object is placed 20 cm from mirror A. Locate the first two nearest image formed by each mirror.
Saturday, September 19, 2015 by trsgts

Physics
Two airplanes leave an airport at the same time. The velocity of the first airplane is 730 m/h at a heading of 44.6 degrees. The velocity of the second is 610 m/h at a heading of 100 degrees. How far apart are they after 2.3 h? Answer in units of m.
Friday, September 18, 2015 by Jeff

mathematics
an Ap has fourth term 8 and 17,find the first term
Friday, September 18, 2015 by chipie

8th Grade Honors History
2. A piece of decorated pottery from the Woodland Era is considered (1 point) a fossil an artifact.** a hieroglyph. a chert 8. During which period of time was the first pottery made? (1 point) Archaic period** Mississippian period Paleo period Woodland period 10. Why were ...
Friday, September 18, 2015 by HardWorker Ms. Sue PLEASE HELP!!!!

math
Which of these numbers is irrational? check mark sign 3 0.25 1/5 check mark sign 9 I think it is the first one
Friday, September 18, 2015 by Lost

calc urgent
Note that f is continuous on (−∞, 6) and (6, ∞). For the function to be continuous on (−∞, ∞), we need to ensure that as x approaches 6, the left and right limits match. First we find the left limit. lim x→6− f(x) = lim x→6...
Friday, September 18, 2015 by Anonymous

calcc
Note that f is continuous on (−∞, 6) and (6, ∞). For the function to be continuous on (−∞, ∞), we need to ensure that as x approaches 6, the left and right limits match. First we find the left limit. lim x→6− f(x) = lim x→6...
Friday, September 18, 2015 by Anonymous

Physics
Two hikers are climbing up a mountain and one throws a first aid kit up to another at an initial velocity of 11 m/s and at an angle of 62 deg above the horizontal. At the moment it is caught, the vertical speed is zero. What is the difference in height between the two climbers...
Thursday, September 17, 2015 by Sarah

Grammar
What is the complete and simple subject in the following sentence? One of the first advocates of medical hygiene and antiseptics was Ignaz Semmelweis.
Thursday, September 17, 2015 by Anonymous

Reading/Writing
Please check my answers to the reading. Reading: MY MOTHER NEVER WORKED By Bonnie Smith-Yackel “Social Security Office.” (The voice answering the telephone sounds very self-assured.) “I’m calling about ... I ... my mother just died ... I was told to call ...
Thursday, September 17, 2015 by Anonymous

Religion
which marriages would not receive God's marriage? First thought that comes to mind is homosexuality but I can't seem to think of anything else? maybe arranged marriages?
Thursday, September 17, 2015 by Anonymous

English
Which of the following is a sentence fragment? A. The first tiny purple crocuses bloomed in February. B. High up in the willow trees in the springtime. C. Covered in snow, the branches reflected the sunlight. Is the answer B? Thank you
Thursday, September 17, 2015 by Skylar

Algebra
a student's work to solve 2 6/7 divided by 2/7 is shown below. which of the following statements do you agree with? 2 6/7 divided by 2/7 = 19/7 divided by 2/7= 7/19 times 2/7= 7/19 times 2/7=2/19 cross out the 7 in the first one put a one and cross out the second one and ...
Thursday, September 17, 2015 by nicloe

Intermediate Algebra (math)
(8x^2y^2+4xy^2-12y^2) ÷ 4xy^2 I received this problem. I was told to divide the rational expression. The problem I am having is I feel like something is missing. I only understand to divide rational expressions we take the first rational expression and multiply it by ...
Thursday, September 17, 2015 by Steph

Intermediate Algebra (math)
(8x^2y^2+4xy^2-12y^2) ÷ 4xy^2 I received this problem. I was told to divide the rational expression. The problem I am having is I feel like something is missing. I only understand to divide rational expressions we take the first rational expression and multiply it by ...
Thursday, September 17, 2015 by Steph

  1. Pages:
  2. <<Prev
  3. 11
  4. 12
  5. 13
  6. 14
  7. 15
  8. 16
  9. 17
  10. 18
  11. 19
  12. 20
  13. 21
  14. 22
  15. 23
  16. 24
  17. 25
  18. Next>>

Homework Help: Health