Wednesday
February 10, 2016

Homework Help: Health: First Aid

Recent Homework Questions About First Aid

chemistry
The temperature at which crystal will first appear when a solution is cooled from 60°c to 20°c?
Saturday, September 26, 2015 by Anonymous

Calculus
Just got through with derivatives, power rule, and chain rule. I am supposed to find the first and second derivatives of the function. y = 4x/√x+1 and y = cos^2(x) y' = [(x+1)^(1/2)(4)]-[(4x)(1/2(x+1)^(-1/2))(​1)] y' = [4(x+1)^(1/2)-4x]/[2(x+1)^(1/2)(x+1)] ...
Saturday, September 26, 2015 by Justin

eced
The rate of physical growth is slow during which period of life? Prenatal development. B.the first year of life. C. Preschool and elementary years. I am think c.
Friday, September 25, 2015 by woody

child development
Which of the following statements concerning the maturation of the reproduction systems is true? A.early menstrual are usually normal.b.in the first months of me strutting girls do not usually ovulate. C. At about 17 boys have their first spontaneous ejaculaTion. I am think c
Friday, September 25, 2015 by Woody

English 11
Check my answers please! 1. Which of the following statements about American Romanticism is nottrue? (1 point) Romanticism in American literature stemmed from Romanticism in British literature.*** Romanticism valued imagination and emotion over reason and intellect. Gothic ...
Friday, September 25, 2015 by Rach

biology-microscope
1. should the aperture diaphragm be adjusted to its most open or its least open setting, to begin? 2.where should the stage be set when you first observe the specimen, using the low power objective lens?
Friday, September 25, 2015 by Anonymous

calculus
Find the point on the curve y =2/3 〖√(18-x^2 )〗 (first quadrant) where a tangent line may be drawn so that the area of the triangle formed by the tangent line and the coordinate axes is a minimum.
Friday, September 25, 2015 by Anonymous

P6 maths
40% of Amy's stamps is equal to 75% of Mary's stamps. After Mary has given 25% of her stamps away , Amy has 90 more stamps than Mary. Find the total number of stamps they have at first
Friday, September 25, 2015 by Jane

Physics
In 1939 or 1940, Emanuel Zacchini took his human-cannonball act to an extreme: After being shot from a cannon, he soared over three Ferris wheels and into a net (see the figure). Assume that he is launched with a speed of 29 m/s and at an angle of 59°. (a) Treating him as ...
Friday, September 25, 2015 by barich

Physics
An incline is divided into 6 equal lengths. Starting from rest a ball accelerates down the incline. It takes 0.21 seconds to reach the first tape marker, a distance of 0.15 meter.
Friday, September 25, 2015 by Sarah

English
Posted by rfvv on Sunday, April 10, 2011 at 9:51pm. He asked me a question. He asked a question of me. He begged me a question. He begged a question of me. He inquired me a question. He inquired me of a question. (Are the pairs all correct and interchangable? Doe they have the...
Thursday, September 24, 2015 by rfvv

biology
Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription is the first step in ...
Thursday, September 24, 2015 by help please

math
Assume you have a basket full of socks, which have the following properties: 6 of the socks have blue stripes 8 of the socks have red polka dots 16 of the socks have blue polka dots 10 of the socks have red stripes (a). If you take one sock out of the basket, what is the ...
Thursday, September 24, 2015 by jordan

Math
Sherry saved $1800 she earned at her summer job. She invested part of her money in a Treasury Bill at 5% and the balance in a Money Market fund which guaranteed a return of 10%. If she earned $165 on her investments in the first year, how much was invested at each rate?
Thursday, September 24, 2015 by Karl

Physics?
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Thursday, September 24, 2015 by Jay

Physics
A car, moving along a straight stretch of high- way, begins to accelerate at 0.014 m/s2. It takes the car 23.2 s to cover 1 km. How fast was the car going when it first began to accelerate? Answer in units of m/s.
Thursday, September 24, 2015 by Bob

Learning Behaviors
describe the temporal pattern of a typical emotional response, occording to the opponet process theory of solomon and corbit.use this theory to account for the different reactions experienced by a first time drug user and an experienced drug user providing two supporting facts...
Thursday, September 24, 2015 by Sabxo

kumasi polytechnic
In A.P the difference between the 8th term and 4th term is 20,and the 8th term is one and half times the 4th term.Find the common difference, and the first term.
Thursday, September 24, 2015 by adjei

biology
Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription is the first step in ...
Thursday, September 24, 2015 by SOS

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
Thursday, September 24, 2015 by Stephanie

Chemistry
Separation of a mixture Lab - SiO2, NaCl, NH4Cl So step #7 was: Carefully pour off (decant) the liquid into the second evaporation dish, Adding deionized water in small amounts to the first dish and to stir it, and pour the liquid again into the second dish. Repeating it. The ...
Wednesday, September 23, 2015 by Abby

Physics
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Wednesday, September 23, 2015 by Jason

Physics(which cone will land first)
consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to predict which ...
Wednesday, September 23, 2015 by Jason

Algebra
A type of plant is introduced into an ecosystem and quickly begins to take over. A scientist counts the number of plants after m months and develops the equation p(m)=19.3(1.089) raised to m, to model the situation. Most recently, the scientist counted 138 plants. Assuming ...
Wednesday, September 23, 2015 by Lina

Math
Paul was given this math problem on a test to simplify: 1/4 + (5/8 + 1/2). after calculating, Paul mistakenly simplified to 9/32 as his final answer In which step did Paul make his first error? Show your work! My work Paul's work 1/4 /9/8 1/4 /(5/8 + 4/8) 1/4 x 8/9 1/4 + 8...
Wednesday, September 23, 2015 by Steve B

Physics
A descent vehicle landing on the moon has a vertical velocity toward the surface of the moon of 34.1 m/s. At the same time, it has a horizontal velocity of 51.1 m/s. At what speed does the vehicle move along its descent path? 1.Answer in units of m/s. 2.At what angle with the ...
Wednesday, September 23, 2015 by Brandon

math
find X if the numbers X+3, 5x-3, and 7x+3 are three consecutive terms of a G.P of positive terms. with this value X and given the X+3, 5x -3 and 7x +3 are the third, fourth and fifth terms of the G.P.. find the sum of the first 8 terms of the progression.
Wednesday, September 23, 2015 by mili

math
You decide you will buy a stock only if it shows an overall increase over the next 30 days. The first 10 days it has an average daily increase of $0.30. The next 10 days it has an average daily decrease of $0.45. The last 10 days it has an average daily increase of $0.25. Will...
Wednesday, September 23, 2015 by SE

probabilty
There are 4 baskets. The first basket has 3 apples and 4 oranges, the second one has 4 apples and 5 mangoes, the third one has 6 Mangoes and 2 bananas and the last one has 7 bananas and 2 apples. If a fruit is randomly chosen from any basket and it comes out to be an apple, ...
Wednesday, September 23, 2015 by sarita

Math
In a third game. Javier first two darts land in R what is the maximum possible score in this game
Wednesday, September 23, 2015 by Sean

Physics
The velocities of sound in media P and Q are 300 meters/second and 350 meters/second respectively. If the difference in wavelength of the two waves in those media is 0.5 meters, what distance will the sound travel in 50 vibrations in the medium Q? The first answer I got was ...
Wednesday, September 23, 2015 by Anon

physics
a cart if weight 25 N is released at the top of an inclined plane of length 1m, which makes an angle of 30 degree with the ground. It rolls down the plane and hits another cart of weight 40 N at the bottom of the incline. Calculate the speed of the first cart at the bottom of ...
Wednesday, September 23, 2015 by ancy

math
what is 7 to the 6th power divided by 7 to the first power.
Wednesday, September 23, 2015 by alex

chemistry/engineering
Wet sugar, containing one-fifth water by mass is conveyed through an evaporator in which 85.0% of the entering water is vaporized. Taking a Basis of 100 kg of feed to the evaporator A barrel of oil contains about 6 million Btu and about 1000 Btu is needed to evaporate one lbm ...
Tuesday, September 22, 2015 by katy

Physics
The tortoise and the hare are in a race of 1000m distance. The tortoise travels the entire race at a speed of 2.0 m/s while the rabbit runs the first 200 m @ 2.0 m/s. Then he stops to take nap for 1.3 hrs and awakens to finish the last 800m with an average speed of 3.0 m/s. ...
Tuesday, September 22, 2015 by Karen

algebra
An “A” is considered 4.0, a “B” is 3.0, a “C” is 2.0, a “D” is 1.0, and an “F” is 0. In your first semester you received the following grades. Calculate your grade point average English = credits 3.0 Grade = C Biology = credits...
Tuesday, September 22, 2015 by Kristen

algebra
Bacteria of species A and species B are kept in a single test tube, where they are fed two nutrients. Each day the test tube is supplied with 19,740 units of the first nutrient and 31,990 units of the second nutrient. Each bacterium of species A requires 4 units of the first ...
Tuesday, September 22, 2015 by Jamie

Half-Life
The rate constant for this first-order reaction is 0.0990 s–1 at 400 °C. A --> products After how many seconds will 10.0% of the reactant remain?
Tuesday, September 22, 2015 by Sam

Geometry
How to put each circle in standard form? 1. Center of the line 5x-3y=12 and tangent to both axes.(first quadrant circle only). 2.passes through (-3,22) and tangent to the y axis at (0,19) 3.diameter ab with a (4,10) and b (8,14) 4. Center (6,10) tangent to the x axis
Tuesday, September 22, 2015 by Please HELP

Please help with this 1
A football team has a net yardage of -26 1/3 yards of a series of plays. The team needs to get yardage of 10 yards to get a first down. How many yards do they have to get on their next play to get a first down?
Tuesday, September 22, 2015 by Step hie

Math
From January 1, 2000 to December 31, 2004, First Bank paid 5% interest, compounded monthly. On January 1, 2005, they lowered their rate to 3% interest, compounded monthly. I deposited $100 at the end of each month beginning in January, 2000. How much did I have in my account ...
Monday, September 21, 2015 by Anon

prealgebra
A school library charges a fine of 5 cents on the first day a book is overdue, then doubles the amount owed each day until payment is made. Jada and Juan each had a book that was overdue. Jada paid a fine that was $2.40 more than Juan’s fine. Which statement about the ...
Monday, September 21, 2015 by Anonymous

physics
Another scheme to catch the roadrunner has failed. A safe falls from rest the top of a 30.2 m high cliff toward Wiley Coyote, who is standing at the base. Wiley first notices the safe after it has fallen 17.4 m. How long does he have to get out of the way? The acceleration of ...
Monday, September 21, 2015 by luma

Punctuation and Capitalization
. Which one of the following sentences has an error in capitalization? A. We crossed the Snake River and miles of nothing much on our way to Abilene. B. That day, across the great river, we got our first view of the Washington Monument. C. My Father has decided to retire in ...
Monday, September 21, 2015 by Anonymous

English
Posted by rfvv on Tuesday, August 26, 2014 at 1:27am. 1. I'll be there(=in prison) for seven years for making fake money. 2. I'll be there (=in prison) for seven years for having made fake money. (Which expression is grammatical?) English - Steve, Tuesday, August 26, ...
Sunday, September 20, 2015 by rfvv

AP Chemistry
An unknown amount of water is mixed with 350 mL of a 6 M solution of NaOH solution. A 75 mL sample of the resulting solution is titrated to neutrality with 52.5 mL of 6 M HCl. Calculate the concentration of the diluted NaOH solution. Answer in units of M I didn't know what...
Sunday, September 20, 2015 by Anonymous

math for managers
f 5 times the first number plus 3 times the second number equals 47, and 10 times the first number minus 4 times the second number equals 54, what are the numbers?
Sunday, September 20, 2015 by Anonymous

math foe managers
f 5 times the first number plus 3 times the second number equals 47, and 10 times the first number minus 4 times the second number equals 54, what are the numbers?
Sunday, September 20, 2015 by Anonymous

Physics
A 0.340 kg particle moves in an xy plane according to x(t) = -15.00 + 2.00t - 4.00t3 and yet) = 25.00 + 7.00t - 9.00t2, with x and y in meters and t in seconds. At t = 0.700 s, what are (a) the magnitude and (b) the angle (relative to the positive direction of the x axis) of ...
Sunday, September 20, 2015 by Haad

physics
A 15-V battery is hooked up to three resistors in series. The voltage drop across the first resistor is 3V and the voltage drop across the sencond resistor is 10V. What is the voltage drop across the last resistor? I don't understand what equation to do for this problem. ...
Saturday, September 19, 2015 by Grace

Social Studies
The leaders of the Virginia Company recruited more settlers and reorganized the colony. They allowed the new settlers to own land. Those settlers began to grow tobacco, a crop they learned about from the Indians. By 1612, Virginians were shipping tobacco to England, which led ...
Saturday, September 19, 2015 by Trent Brown

History
The Caddo lived on a million acres of land. What characteristics of their culture demonstrated a need for vast amounts of land? A. They made and traded intricate pottery. B. They hunted Bison and raised cattle, hogs, and poultry on farms. C. They worked on boats along shores. ...
Saturday, September 19, 2015 by Shi Buringa

English
Jay Z has multiple sides to him; he teaches us how to be a successful person, and show us what's important in life v.s. what's not. Is this a good thesis sentence, and also can you give me example of the first part of the sentence and the last part ofd the sentence
Saturday, September 19, 2015 by Mrs. Keon Meadows

Science- Physics
Two plane mirrors, A and B, are separated by 30.0 cm facing each other. An object is placed 20 cm from mirror A. Locate the first two nearest image formed by each mirror.
Saturday, September 19, 2015 by trsgts

Physics
Two airplanes leave an airport at the same time. The velocity of the first airplane is 730 m/h at a heading of 44.6 degrees. The velocity of the second is 610 m/h at a heading of 100 degrees. How far apart are they after 2.3 h? Answer in units of m.
Friday, September 18, 2015 by Jeff

mathematics
an Ap has fourth term 8 and 17,find the first term
Friday, September 18, 2015 by chipie

8th Grade Honors History
2. A piece of decorated pottery from the Woodland Era is considered (1 point) a fossil an artifact.** a hieroglyph. a chert 8. During which period of time was the first pottery made? (1 point) Archaic period** Mississippian period Paleo period Woodland period 10. Why were ...
Friday, September 18, 2015 by HardWorker Ms. Sue PLEASE HELP!!!!

math
Which of these numbers is irrational? check mark sign 3 0.25 1/5 check mark sign 9 I think it is the first one
Friday, September 18, 2015 by Lost

calc urgent
Note that f is continuous on (−∞, 6) and (6, ∞). For the function to be continuous on (−∞, ∞), we need to ensure that as x approaches 6, the left and right limits match. First we find the left limit. lim x→6− f(x) = lim x→6...
Friday, September 18, 2015 by Anonymous

calcc
Note that f is continuous on (−∞, 6) and (6, ∞). For the function to be continuous on (−∞, ∞), we need to ensure that as x approaches 6, the left and right limits match. First we find the left limit. lim x→6− f(x) = lim x→6...
Friday, September 18, 2015 by Anonymous

Physics
Two hikers are climbing up a mountain and one throws a first aid kit up to another at an initial velocity of 11 m/s and at an angle of 62 deg above the horizontal. At the moment it is caught, the vertical speed is zero. What is the difference in height between the two climbers...
Thursday, September 17, 2015 by Sarah

Grammar
What is the complete and simple subject in the following sentence? One of the first advocates of medical hygiene and antiseptics was Ignaz Semmelweis.
Thursday, September 17, 2015 by Anonymous

Reading/Writing
Please check my answers to the reading. Reading: MY MOTHER NEVER WORKED By Bonnie Smith-Yackel “Social Security Office.” (The voice answering the telephone sounds very self-assured.) “I’m calling about ... I ... my mother just died ... I was told to call ...
Thursday, September 17, 2015 by Anonymous

Religion
which marriages would not receive God's marriage? First thought that comes to mind is homosexuality but I can't seem to think of anything else? maybe arranged marriages?
Thursday, September 17, 2015 by Anonymous

English
Which of the following is a sentence fragment? A. The first tiny purple crocuses bloomed in February. B. High up in the willow trees in the springtime. C. Covered in snow, the branches reflected the sunlight. Is the answer B? Thank you
Thursday, September 17, 2015 by Skylar

Algebra
a student's work to solve 2 6/7 divided by 2/7 is shown below. which of the following statements do you agree with? 2 6/7 divided by 2/7 = 19/7 divided by 2/7= 7/19 times 2/7= 7/19 times 2/7=2/19 cross out the 7 in the first one put a one and cross out the second one and ...
Thursday, September 17, 2015 by nicloe

Intermediate Algebra (math)
(8x^2y^2+4xy^2-12y^2) ÷ 4xy^2 I received this problem. I was told to divide the rational expression. The problem I am having is I feel like something is missing. I only understand to divide rational expressions we take the first rational expression and multiply it by ...
Thursday, September 17, 2015 by Steph

Intermediate Algebra (math)
(8x^2y^2+4xy^2-12y^2) ÷ 4xy^2 I received this problem. I was told to divide the rational expression. The problem I am having is I feel like something is missing. I only understand to divide rational expressions we take the first rational expression and multiply it by ...
Thursday, September 17, 2015 by Steph

Social Studies
The first Englishman who wanted to build a “future Eden” where luxurious items, such as coffee, tea, figs currants, olives, rice and silk, would be produced. This paradise was to be called is it the margravate of azilia?
Wednesday, September 16, 2015 by brooke

Writing
Please check my rewrites (the ones with a black dot/bullet). Thank you! a. The importance of your family. Thesis: The success of a child depends on the support of his or her family. * I think this is debatable because the other side could argue that the success of a child ...
Wednesday, September 16, 2015 by Anonymous

chemistry
Oganic solvents are not suited to be heated with one of the followings: Oil Bath Electric hot plate Water bath Bunsen burner flame 2 Which of the following is not an inflammable liquid ? Water Ethanol Kerosine Benzene 3 These are some safety precausions necessary in a ...
Wednesday, September 16, 2015 by onyi

chemistry
When chemicals pour on the skin, the laboratory first aid is to ---------------. Apply 1% sodium carbonate Apply 1% boric acid solution Flush the eye with a copious amount of clean lukewarm running water Wash with soap and warm water 2 For cut sustained in the laboratory ...
Wednesday, September 16, 2015 by onyi

History
The first Englishman who wanted to build a “future Eden” where luxurious items, such as coffee, tea, figs currants, olives, rice and silk, would be produced. This paradise was to be called
Wednesday, September 16, 2015 by brooke

science!
i want you to review the (3)descriptions and the (4)questions and correct my answers of this worksheet called Scientific Method Bikini Bottom Experiments. tank you tutors for reviewing the descriptions and questions and correcting my answers. The Bikini Bottom gang loves ...
Tuesday, September 15, 2015 by anon

ap biology
If you have fluid in the pipet tip and want to expel it all, should you only depress the plunger to the first stop or should you continue on to the second stop? why not choose the other option? what could happen?
Tuesday, September 15, 2015 by Anonymous

ap biology
if you depress the plunger to the first stop, place the tip into a solution and then release the plunger, does it withdraw the sample, expel the sample, or eject the tip?
Tuesday, September 15, 2015 by Anonymous

English
Will someone assist me in answering the first question below? Once I figure out an answer for the first question, I should be able to answer the other two. "Hobbits are an unobtrusive but very ancient people, more numerous formerly than they are today; for they love peace...
Tuesday, September 15, 2015 by Victoria

Chemistry
Calculate the enthalpy change (ΔH) for: HCl(aq) + NH3(aq) → NH4Cl(aq) The reaction of 50.0 mL of 1.00 M HCl with 50.0 mL of 1.00 M NH3 causes a temperature rise of 6.4 ˚C in the resulting 100.0 mL of solution. The NH4Cl solution has a density of 1.005 g/mL and ...
Tuesday, September 15, 2015 by Jim

ms sue help me please
In the following literature selections, individuals experience rites of passage in various ways: The bass, The river and Sheila Mant Oranges I know why the Caged Bird Sings First lesson On Turning Ten Hanging Fire My Forbidden Face The Scarlet Ibis My Brother's Keeper ...
Tuesday, September 15, 2015 by countryboy15

reading
If you were reading a story and you came across a word you dont know, where would be the first place you would look for a definition -- glossary or a dictionary? I think glossary am i correct?
Tuesday, September 15, 2015 by hanah

English (I am unsure)
Identify the purpose of this writing. Some people love the Everglades; as for me, I agree with the contest people who said their first prize was one week in the Everglades, and their second prize was two weeks in the Everglades. A. To inform B. To persuade C. To entertain D. ...
Tuesday, September 15, 2015 by Victoria

English help please
9. The author of "My Brother's Keeper" mainly develops Jamie’s character through his actions *dialogue and thoughts the narrators description other’s reaction to him 10. In "My Brother's Keeper," what does Ted want Jamie to do for him? ...
Tuesday, September 15, 2015 by Anonymous

English (Please, Check My Answers)
Identify the various purposes in writing. 1. We thought our first day in the Everglades would be dull, but one impatient girl in our group proved us very, very wrong. Chief purpose: To narrate 2. On that day in the Everglades everything dripped--the cypresses and live oaks ...
Tuesday, September 15, 2015 by Victoria

Writing
Please check my rewrites (the ones with a black dot/bullet). Thank you! a. The importance of your family. Thesis: The success of a child depends on the support of his or her family. * I think this is debatable because the other side could argue that the success of a child ...
Tuesday, September 15, 2015 by Anonymous

English
Identify the various purposes in writing. 1. We thought our first day in the Everglades would be dull, but one impatient girl in our group proved us very, very wrong. Chief purpose: To narrate 2. On that day in the Everglades everything dripped--the cypresses and live oaks ...
Tuesday, September 15, 2015 by Victoria

Writing
Please check my rewrites (the ones with a black dot/bullet). Thank you! a. The importance of your family. Thesis: The success of a child depends on the support of his or her family. * I think this is debatable because the other side could argue that the success of a child ...
Tuesday, September 15, 2015 by Anonymous

Writing
Formulate a workable thesis statement for each of the following general subjects and topics. Please give me some feedbacks on my thesis statements. Thank you! a. The importance of your family. Thesis: The success of a child depends on the support of his or her family. * I ...
Tuesday, September 15, 2015 by Anonymous

Social Studies
Please check my answers :) 1. Which of the following means producing just enough to meet the families' needs, with little left to sell or exchange? a. harvesting b. substance farming**** c. cash crop d. tidewater farming 2. The Proclamation of 1763 called for a. settlers ...
Tuesday, September 15, 2015 by Alexis

Math
you have a piece of wood that is 144 inches long. you cut it into three pieces. the second piece is 12 inches longer than the first piece. the third piece is 12 inches longer than the second piece. write and solve the equation to find the lengths of the three pieces
Tuesday, September 15, 2015 by Mark

Algebra
Larry invested a total of $5000 in three stocks during the first year the first stock increasing value by 8% the second stock increase by 6% and the third stock increase by 1% in the first year he earn a profit $310 if Larry invested the same amount in the stock that increased...
Tuesday, September 15, 2015 by Lupe

Math
Romain,fabien,lise,jen and adrien stand in a single row.romain is after lise.fabien is before romain and just after jennifer.jennifer is before lise but she is not d first.where iS adrien?
Monday, September 14, 2015 by John

Science
Luis is an avid baseball player. For his science project, he decides to test which type of bat is best for hitting home runs. Luis prefers to use an aluminum bat when he plays, so he hypothesizes that he will hit more home runs using an aluminum bat than a wooden bat. During ...
Monday, September 14, 2015 by lizbeth

science
Luis is an avid baseball player. For his science project, he decides to test which type of bat is best for hitting home runs. Luis prefers to use an aluminum bat when he plays, so he hypothesizes that he will hit more home runs using an aluminum bat than a wooden bat. During ...
Monday, September 14, 2015 by lizbeth

Math
The local health club is advertising a special for new members: no initiation fee to join and lnly $34.50 per month for the first year. If Andy joins the health club for one year, how much will he spend on membership?
Monday, September 14, 2015 by AJ

math 208
parking in a student lot cost 3.00 for the first half hour and 1.25 for each hour there after a partial hour is change the same as a full hour what is the longesr time that student can park
Monday, September 14, 2015 by Anonymous

History
1) Why were New Mexicans affected by the Bataan Death March? A)Military bases in New Mexico trained pilots to fly over the Bataan Death March. B)The United States declared war on Japan because of the Bataan Death March. C)The Bataan Death March happened in New Mexico. D)Many ...
Monday, September 14, 2015 by Appreciated Help

inglesh
In “The Raven and the First Men: The Beginnings of the Haida,” which evidence best helps the reader infer that the Haida might find it acceptable behavior to play tricks on one another? The story presents Raven’s trick against the Sky Chief in a matter-of-fact ...
Monday, September 14, 2015 by Anonymous

math
may u help me with 2x+3c=42...im not sure what step to take first
Monday, September 14, 2015 by noni

Buisness
Hello! I'm taking a test for my business class and I'm having trouble with these questions. If someone could check my answers I would really appreciate it! Thank you! 6. Asking yourself "What can I do to build a loyal customer base?" is an example of A. ...
Monday, September 14, 2015 by Maliya

Buisness
I took a test for my business class and I'm having trouble with these questions. Any help would be appreciated! Thank you! 5.Jim is beginning his research on franchise businesses in order to find one that meets his needs. A quick, easy way to get general information is to ...
Monday, September 14, 2015 by Maliya

  1. Pages:
  2. <<Prev
  3. 4
  4. 5
  5. 6
  6. 7
  7. 8
  8. 9
  9. 10
  10. 11
  11. 12
  12. 13
  13. 14
  14. 15
  15. 16
  16. 17
  17. 18
  18. Next>>

Homework Help: Health