b) Make a single base pair substitution mutation in the gene below that results in a protein that is shorter than the protein produce by the original gene. When you are satisfied with your change and its effect, click the "Final Check" button.

Note that a "single base pair substitution mutation" is when a single base is changed to another base. Deletions and insertions are not allowed.
DNA: PromoterTerminator
10 20 30 40 50 60 70 80 90
. | . | . | . | . | . | . | . | . |
5'-CGCGTATAACCATGCCCGTACTAGTGCGCTTTTTAGTGATGGACAAAGAAATGGCTGTGGTACGTGCGTTTTTCAAAGCTGTCAGGAGTAGGGGGCTA-3'
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'-GCGCATATTGGTACGGGCATGATCACGCGAAAAATCACTACCTGTTTCTTTACCGACACCATGCACGCAAAAAGTTTCGACAGTCCTCATCCCCCGAT-5'
pre-mRNA: Exon Intron
5'-CCAUGCCCGUACUAGUGCGCUUUUUAGUGAUGGACAAAGAAAUGGCUGUGGUACGUGCGUUUUUCAAAGCUGUCAGGAGUA-3'
mature-mRNA and Protein (previous):
5'-CCAUGCCCGUACUAAAAUGGCUGUGGUACCUGUCAGGAGUAAAAAAAAAAAAAA-3'
N-MetProValLeuLysTrpLeuTrpTyrLeuSerGlyValLysLysLysLys-C

To make a single base pair substitution mutation in the gene that results in a shorter protein, we need to identify a base pair that, when changed, introduces a premature stop codon in the mRNA sequence. This premature stop codon will cause the protein to be shorter as translation will terminate earlier.

Looking at the DNA sequence, we can analyze each codon and identify a base pair where a substitution can create a stop codon. Remember that a stop codon is represented by TAA, TAG, or TGA in the mRNA sequence.

In this case, we can see that the codon "GGA" (corresponding to Gly) at position 55-57 in the DNA sequence can be mutated to "TGA". This single base pair substitution changes the codon to a stop codon, resulting in premature termination of translation.

After the mutation, the DNA sequence will look like this:

5'-CGCGTATAACCATGCCCGTACTAGTGCGCTTTTTAGTGATGGACAAAGAAATGGCTGTGGTACGTGA

The corresponding pre-mRNA, mature mRNA, and protein (after the substitution) will be as follows:

pre-mRNA: Exon Intron
5'-CCAUGCCCGUACUAGUGCGCUUUUUAGUGAUGGACAAAGAAAUGGCUGUGGUACGUGCGUUUUUCAAAGCUGUCAGGAGUA-3'

mature-mRNA and Protein (after the substitution):
5'-CCAUGCCCGUACUAAAAUGGCUGUGGUACU-3'
N-MetProValLeuLysStop

This single base pair substitution mutation introduced a premature stop codon, resulting in a shorter protein.