b) Make a single base pair substitution mutation in the gene below that results in a protein that is shorter than the protein produce by the original gene. When you are satisfied with your change and its effect, click the "Final Check" button.

Note that a "single base pair substitution mutation" is when a single base is changed to another base. Deletions and insertions are not allowed.
DNA: PromoterTerminator
10 20 30 40 50 60 70 80 90
. | . | . | . | . | . | . | . | . |
5'-CGCGTATAACCATGCCCGTACTAGTGCGCTTTTTAGTGATGGACAAAGAAATGGCTGTGGTACGTGCGTTTTTCAAAGCTGTCAGGAGTAGGGGGCTA-3'
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'-GCGCATATTGGTACGGGCATGATCACGCGAAAAATCACTACCTGTTTCTTTACCGACACCATGCACGCAAAAAGTTTCGACAGTCCTCATCCCCCGAT-5'
pre-mRNA: Exon Intron
5'-CCAUGCCCGUACUAGUGCGCUUUUUAGUGAUGGACAAAGAAAUGGCUGUGGUACGUGCGUUUUUCAAAGCUGUCAGGAGUA-3'
mature-mRNA and Protein (previous):
5'-CCAUGCCCGUACUAAAAUGGCUGUGGUACCUGUCAGGAGUAAAAAAAAAAAAAA-3'
N-MetProValLeuLysTrpLeuTrpTyrLeuSerGlyValLysLysLysLys-C

To make a single base pair substitution mutation in the gene that results in a shorter protein, we need to identify a base pair within the codons that can be changed. In this case, we can identify the codon that codes for the amino acid sequence "LysTrpLeuTrpTyr" in the mature-mRNA and protein section.

The codon in question is "AUG," which codes for the amino acid methionine (Met) and serves as the start codon. To make a single base pair substitution, we need to change one of the bases within this codon to a different base.

Let's change the second base of the codon from "U" to "A". This will result in the new codon "AAG", which codes for the amino acid lysine (Lys). As a result, the amino acid sequence will change from "LysTrpLeuTrpTyr" to "LysTrpLysTrpTyr."

The resulting mature-mRNA and protein sequence would be:
5'-CCAUGCCCGUACAAGAUGGCUGUGGUAC-3'
N-MetProValGlnLysMetLeuTrpTyr

This single base pair substitution mutation leads to a premature stop codon and results in a shorter protein compared to the original gene.