Questions Science
if dna sequence is altered how will protein made change?
If the amino acid is changed, the tertiary structure (interaction between R groups) will be changed. As a result, the protein's structure(/folding) and therefore function will be different.
You can ask a new question or answer this question .
Similar Questions
Top answer:
1. One or more base pairs are accidentally inserted into a DNA sequence during DNA replication. 2. A
Read more.
Top answer:
1. One or more base pairs are accidentally inserted into a DNA sequence during DNA replication. 2. A
Read more.
Top answer:
c sequence of nitrogen bases in a strand of messenger RNA, and the protein made
Read more.
Top answer:
1. One or more base pairs are accidentally inserted into a DNA sequence during DNA replication. 2. A
Read more.
Top answer:
Based on the given information, let's break down the problem and address your questions. 1. You have
Read more.
Top answer:
A harmful change for the organism
Read more.
ORIGINAL DNA: GATTGCACGGAGTTGCCAAG Ear Shape Finger Length Hair Type The DNA sequence above was copied during protein synthesis
Top answer:
the finger length phenotype will be affected by the copy of DNA genotype an error occurred in the
Read more.
Top answer:
C) change in the DNA sequence.
Read more.
Top answer:
change in the DNA sequence.
Read more.
Top answer:
change in the DNA sequence.
Read more.