Friday
March 24, 2017

Post a New Question

Posted by on .

The following DNA segment has one ORF. Do you know what it codes for?

5'-TAGGATGTTCGACATGTAAGCTT

ATCCTACAAGCTGTACATTCGAA

  • Genetics - ,

    This i s not my area, but you might like to have some of the following Genetics Tutorials:

    https://www.google.com/search?q=Genetics+Tutorials&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a

    Sra

Answer This Question

First Name:
School Subject:
Answer:

Related Questions

More Related Questions

Post a New Question