Wednesday
August 5, 2015

Homework Help: Genetics

Posted by Tony on Thursday, November 10, 2011 at 3:08am.

The following DNA segment has one ORF. Do you know what it codes for?

5'-TAGGATGTTCGACATGTAAGCTT

ATCCTACAAGCTGTACATTCGAA

Answer this Question

First Name:
School Subject:
Answer:

Related Questions

More Related Questions

Members